| 1. |
- Abel, Frida, 1974, et al.
(författare)
-
Gain of chromosome arm 17q is associated with unfavourable prognosis in neuroblastoma, but does not involve mutations in the somatostatin receptor 2(SSTR2) gene at 17q24.
- 1999
-
Ingår i: British journal of cancer. - : Springer Science and Business Media LLC. - 0007-0920 .- 1532-1827. ; 81:8, s. 1402-9
-
Tidskriftsartikel (refereegranskat)abstract
- Deletion of chromosome arm 1p and amplification of the MYCN oncogene are well-recognized genetic alterations in neuroblastoma cells. Recently, another alteration has been reported; gain of the distal part of chromosome arm 17q. In this study 48 neuroblastoma tumours were successfully analysed for 17q status in relation to known genetic alterations. Chromosome 17 status was detected by fluorescence in situ hybridization (FISH). Thirty-one of the 48 neuroblastomas (65%) showed 17q gain, and this was significantly associated with poor prognosis. As previously reported, 17q gain was significantly associated with metastatic stage 4 neuroblastoma and more frequently detected than both deletion of chromosome arm 1p and MYCN amplification in tumours of all stages. 17q gain also showed a strong correlation to survival probability (P = 0.0009). However, the most significant correlation between 17q gain and survival probability was observed in children with low-stage tumours (stage 1, 2, 3 and 4S), with a survival probability of 100% at 5 years from diagnosis for children with tumours showing no 17q gain compared to 52.5% for those showing 17q gain (P = 0.0021). This suggests that 17q gain as a prognostic factor plays a more crucial role in low-stage tumours. Expression of the somatostatin receptor 2 (SSTR2), localized in chromosome region 17q24, has in previous studies been shown to be positively related to survival in neuroblastoma. A point mutation in the SSTR2 gene has earlier been reported in a human small-cell lung cancer. In this study, mutation screening of the SSTR2 gene in 43 neuroblastoma tumours was carried out with polymerase chain reaction-based single-stranded conformation polymorphism/heteroduplex (SSCP/HD) and DNA sequencing, and none of the tumours showed any aberrations in the SSTR2 gene. These data suggest that mutations in the SSTR2 gene are uncommon in neuroblastoma tumours and do not correlate with either the 17q gain often seen or the reason some tumours do not express SSTR2 receptors. Overall, this study indicates that gain of chromosome arm 17q is the most frequently occurring genetic alteration, and that it is associated with established prognostic factors.
|
|
| 2. |
- Jemt, Torsten, 1950, et al.
(författare)
-
Accuracy of implant-supported prostheses in the edentulous jaw: analysis of precision of fit between cast gold-alloy frameworks and master casts by means of a three-dimensional photogrammetric technique.
- 1995
-
Ingår i: Clinical Oral Implants Research. - : Wiley. - 0905-7161 .- 1600-0501. ; 6:3, s. 172-80
-
Tidskriftsartikel (refereegranskat)abstract
- Distortions of 15 routine implant-supported prostheses were measured in relation to the master casts after completion by means of a 3-dimensional (3-D) photogrammetric technique. All prostheses were designed as one-piece gold-alloy castings with resin teeth. Five of the prostheses were placed in the edentulous maxilla, and the remaining were placed in the lower jaw. Distortion of the cylinders was mostly observed in the horizontal plane (x- and y-axis) while the vertical aspect seemed to be more stable. The mean 3-D center point distortion was 42 (SD 15) and 74 (SD 38) microns for the upper and lower jaws, respectively. The measurements revealed a range of 3-D center point distortion from 16 to 80 and 15 to 165 microns for the different jaws, respectively. The corresponding 3-D mean angular distortion of the cylinders was 51 (SD 35) microns in lower and 70 (SD 75) microns in the upper jaws. A correlation was found between 3-D center point distortion and the width as well as the curvature of the implant arch, indicating more displacement the wider and the more curved the arch was. The 3-D center point distortion was also significantly higher in the upper jaws which could possibly be explained by the curvature of the implant arch and higher numbers of implants in the upper jaws. Further problems with the fit of upper jaw castings could be related to more alloy in the castings and poor alignment of implants.
|
|
| 3. |
- Pradhan, P., et al.
(författare)
-
Induced Circular Dichroism of Benzo(a)pyrene-7,8-dihydrodiol 9,10-Epoxide Stereoisomers Covalently Bound to Deoxyribooligonucleotides Used to Probe Equilibrium Distribution between Groove Binding and Intercalative Adduct Conformations
- 1998
-
Ingår i: Biochemistry. - : American Chemical Society (ACS). - 1520-4995 .- 0006-2960. ; 37:13, s. 4664-4673
-
Tidskriftsartikel (refereegranskat)abstract
- Binding conformations of single anti-BPDE-N-2-dG adducts in oligonucleotides of varying base composition have been studied by induced circular dichroism (ICD). The sign of the ICD around 350 nm of single-stranded oligonucleotide adducts and the sign of an exciton type of CD component at 260 nm in both single strand and duplex farms of adducts correlate with the absolute configuration of the cyclohexyl moiety of the adduct. Changes in magnitude and sign of the ICD around 350 nm were observed upon duplex formation. The results show that adducts displaying external (minor groove) binding characteristics are associated with a significant positive ICD. Conversely, adducts displaying intercalation binding characteristics were found to have a positive or negative ICD. The magnitude of the ICD is dependent on the sequence context and the particular adduct isomer studied. Duplexes with (+)-trans-anti-BPDE-N-2-dG in 5'-d(CCTATCGCTATCC) or 5'-d(CCTATAGATATCC) exhibit a relatively strong positive ICD. In contrast, the duplexes with (+)-trans-anti-BPDE-N-2-dG in 5'-d(CCTATTGCTATCC) and 5'-d(CCTATTGTTATCC) display a small positive and negative ICD, respectively, in both cases suggesting conformational heterogeneity. Partially complementary duplexes (dA, dT, or do) localized opposite the (+)-trans-anti-BPDE-N-2-dG adduct in 5'-d(CCTATCGCTATCC) or 5'-d(CCTATAGATATCC) also demonstrated negative ICD. These results together with light absorption characteristics suggest a preferred conformation of intercalation for the mismatched duplexes. Evidence of an equilibrium between the external and intercalative adduct conformation is provided by the results from the temperature dependence of the near-UV absorption and ICD characteristics of (+)-trans-anti-BPDE-N-2-dG complex in a 5'-d(CCTATAGATATCC) duplex.
|
|
| 4. |
- Pradhan, P., et al.
(författare)
-
Studies on the Adduct Heterogeneity of Benzo(a)pyrene 7,8-Dihydrodiol 9,10-Epoxide Stereoisomers Covalently Bound to Deoxyribooligonucleotides by Induced Circular Dichroism and Light Absorption Spectroscopy
- 1999
-
Ingår i: Chemical Research in Toxicology. - : American Chemical Society (ACS). - 1520-5010 .- 0893-228X. ; 12:5, s. 403-411
-
Tidskriftsartikel (refereegranskat)abstract
- The binding conformations of single anti- and syn-BPDE-N-2-dG adducts in oligonucleotides of varying base composition have been studied by induced circular dichroism (ICD) and light absorption spectroscopy. The sign of the ICD in single-stranded oligonucleotide adducts correlates with the absolute configuration of the cyclohexyl moiety of the BPDE. Adducts in oligonucleotide duplexes with UV lambda(max) 350 nm exhibiting either positive or negative contributions to the ICD should have intercalated binding as the predominant conformation. The magnitude of the ICD is dependent on the sequence context of the adducted strand and the particular BPDE-adduct isomer under study. In some cases, the results suggest structural heterogeneity. For instance, the (+)- and the (-)-trans-anti-BPDE-N-2-dG adducts in duplexes where a dT flanks the lesion site exhibit weak positive ICD or negative ICD. These results reflect a bimodal conformational adduct distribution with contributions from both externally and internally located adducts. A key observation for the (+)-cis-syn-BPDE-N-2-dG complexes in 5'-d(TGC) and 5'-d(CGC) sequence contexts is that the near-UV absorption spectra showed distinct bands corresponding to minor groove binding (lambda(max) congruent to 346 nm) as well as intercalative binding (lambda(max) congruent to 354 nm). Evidence for an equilibrium between the different modes of localization is provided by the results from the temperature dependence of the near-UV absorption and ICD characteristics of(+)-cis-synBPDE-N-2-dG complexes in 5'-d(TGC) and 5'-d(CGC) sequence contexts, respectively.
|
|
| 5. |
- Sehlstedt, U., et al.
(författare)
-
Interactions of the Antiviral Quinoxaline Derivative 9-OH-B220 {2,3-dimethyl-6-(dimethylaminoethyl)-9-hydroxy-6H-indolo-[2,3-b] quinoxaline} with Duplex and Triplex forms of Synthetic DNA and RNA
- 1998
-
Ingår i: Journal of Molecular Biology. - : Elsevier BV. - 0022-2836 .- 1089-8638. ; 278:1, s. 31-56
-
Tidskriftsartikel (refereegranskat)abstract
- The binding of an antiviral quinoxaline derivative, 2,3-dimethyl-6-(dimethylaminoethyl)-9 -hydroxy-6H-indolo-[2,3-b]quinoxaline (9-OH-B220), to synthetic double and triple helical DNA (poly(dA).poly(dT) and poly(dA.)2poly(dT)) and RNA (poly(rA).poly(rU) and poly(rA) .2poly(rU)) has been characterized using flow linear dichroism (LD), circular dichroism (CD), fluorescence spectroscopy, and thermal denaturation. When either of the DNA structures or the RNA duplex serve as host polymers a strongly negative LD is displayed, consistent with intercalation of the chromophoric ring system between the base-pairs/triplets of the nucleic acid structures. Evidence for this geometry also includes weak induced CD signals and strong increments of the fluorescence emission intensities upon binding of the drug to each of these polymer structures. Ln agreement with intercalative binding, 9-OH-B220 is found to effectively enhance the thermal stability of both the double and triple helical states of DNA as well as the RNA duplex. Ln the case of poly(dA).2poly(dT), the drug provides an unusually large stabilization of its triple helical state; upon binding of 9-OH-B220 the tripler-to-duplex equilibrium is shifted towards higher temperature by 52.5 deg. C in a 10 mM sodium cacodylate buffer (pH 7.0) containing 100 mM NaCl and 1 mM EDTA.When triplex RNA serves as host structure, LD indicates that the average orientation angle between the drug chromophore plane and the helix axis of the triple helical RNA is only about 60 to 65 degrees. Moreover, the thermal stabilizing capability, as well as the fluorescence increment, CD inducing power and perturbations of the absorption envelope, of 9-OH-B220 in complex with the RNA tripler are all less pronounced than those observed for the complexes with DNA and duplex RNA. These features indicate binding of 9-OH-B220 in the wide and shallow minor groove of poly(rA).2poly(rU).Based on the present results, some implications for the applications of this low-toxic, antiviral and easily administered drug in an antigene strategy, as well as its potential use as an antiretroviral agent, are discussed
|
|
| 6. |
- Wassenius, Ola, et al.
(författare)
-
Variability in Skin Exposure in Machine Operators Exposed to Cutting Fluids
- 1998
-
Ingår i: Scandinavian Journal of Work, Environment and Health. - : Scandinavian Journal of Work, Environment and Health. - 0355-3140 .- 1795-990X. ; 24:2, s. 125 - 129
-
Tidskriftsartikel (refereegranskat)abstract
- Objective. This study describes a new technique for measuring skin exposure to cutting fluids and evaluates the variability of skin exposure among machine operators performing cyclic (repetitive) work. Methods. The technique is based on video recording and subsequent analysis of the videotape by means of computer-synchronized video equipment. The time intervals at which the machine operator's hand was exposed to fluid were registered, and the total wet time of the skin was calculated by assuming different evaporation times for the fluid. The exposure of twelve operators with different work methods was analyzed in six different workshops, which included a range of machine types, from highly automated metal cutting machines (ie, actual cutting and chip removal machines) requiring operator supervision to conventional metal cutting machines, where the operator was required to maneuver the machine and manually exchange products. Results; the relative wet time varied between 0% and 100%. A significant association between short cycle time and high relative wet time was noted. However, there was no relationship between the degree of automatization of the metal cutting machines and wet time. Conclusions. The study shows that skin exposure to cutting fluids can vary considerably between machine operators involved in manufacturing processes using different types of metal cutting machines. The machine type was not associated with dermal wetness. The technique appears to give objective information about dermal wetness. A comment: This publication is a result of a cooperation between the authors at Chalmers University of Technology and Gothenburg University, i.e. between the Department of Transportation and the Department of Occupational Health and the Department of Sociology.
|
|
| 7. |
- Wittung, Pernilla, 1968, et al.
(författare)
-
Fluorescence-detected interactions of oligonucleotides in RecA complexes
- 1995
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 368:1, s. 64-68
-
Tidskriftsartikel (refereegranskat)abstract
- A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA, The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible, The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed, In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur.
|
|
