↓ Direkt till sidans innehåll
↓ Direkt till sidans sekundära innehåll (sidomenyn)

Träfflista för sökning "db:Swepub ;conttype:(scientificother);lar1:(uu);pers:(Chattopadhyaya J);spr:eng"

Sökning: db:Swepub > Övrigt vetenskapligt/konstnärligt > Uppsala universitet > Chattopadhyaya J > Engelska

Resultat 41-50 av 65

Sortera/gruppera träfflistan

Sortering: Träffar per sida:

Numrering	Referens	Omslagsbild	Hitta
41.	Plavec, J, et al. (författare) Comparative assessment of structure and reactivity of Wyosine by chemistry, spectroscopy and ab initio calculations 1996 Ingår i: TETRAHEDRON. - : PERGAMON-ELSEVIER SCIENCE LTD. - 0040-4020. ; 52:5, s. 1597-1608 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract The hypermodified fluorescent Y-nucleosides (Wyosine, 1a) and its 7-substituted congeners occur naturally adjacent to the 3'-end of the anticodon loop in yeast phenylalanine transfer RNA (tRNA(Phe)). The biological importance of Wyosine is emphasised by t
42.	Plavec, J, et al. (författare) How do the energetics of the stereoelectronic gauche and anomeric effects modulate the conformation of nucleos(t)ides? 1996 Ingår i: PURE AND APPLIED CHEMISTRY. - : BLACKWELL SCIENCE LTD. - 0033-4545. ; 68:11, s. 2137-2144 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract The determination of the energetics of the temperature-dependent two-state N reversible arrow S pseudorotational equilibrium through (3)J(HH) analysis in 36 nucleos(t)ides and 3 abasic sugars has allowed us for the first time to quantify the strength of v
43.	Plavec, J, et al. (författare) Pseudorotation of the sugar moiety in pyrimidine nucleosides occurs on the same time-scale as the overall tumbling: H-2 NMR relaxation time study 1998 Ingår i: MAGNETIC RESONANCE IN CHEMISTRY. - : JOHN WILEY & SONS LTD. - 0749-1581. ; 36:10, s. 732-740 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract The molecular motions of specifically deuterated thymidines 1-5a and two C-3-deuterated allofuranoses 6 and 7 were studied through temperature-dependent H-2 and C-13 relaxation times. Deuterium relaxation times in 1-5a were found in the range 20-270 ms be
44.	PLAVEC, J, et al. (författare) REPARAMETRIZATION OF KARPLUS EQUATION RELATING (3)J(C-C-O-P) TO TORSION ANGLE 1995 Ingår i: TETRAHEDRON LETTERS. - : PERGAMON-ELSEVIER SCIENCE LTD. - 0040-4039. ; 36:11, s. 1949-1952 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract A new three-parameter Karplus equation (3)J(C-C-O-P) = 9.1 cos(2) Phi - 1.9 cos Phi + 0.8 is based on the 17 (3)J(CP) coupling constants and the corresponding X-ray derived torsion angles giving an r.m.s. of 0.3 Hz and Delta J < 0.5 Hz between J(exp) and
45.	PLAVEC, J, et al. (författare) THE INTERACTION OF THE 2'-OH GROUP WITH THE VICINAL PHOSPHATE IN RIBONUCLEOSIDE 3'-ETHYLPHOSPHATE DRIVES THE SUGAR-PHOSPHATE BACKBONE INTO UNIQUE (S,EPSILON(-)) CONFORMATIONAL STATE 1995 Ingår i: TETRAHEDRON. - : PERGAMON-ELSEVIER SCIENCE LTD. - 0040-4020. ; 51:43, s. 11775-11792 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract The analysis of temperature-dependent vicinal proton-proton coupling constants has shown that the North (N) reversible arrow South (S) pseudorotational equilibria of ribonucleoside 3'-ethylphosphates [ApEt (21), GpEt (22), CpEt (23), rTpEt (24) and UpEt (
46.	Polak, M, et al. (författare) The change in the electronic character upon cisplatin binding to guanine nucleotide is transmitted to drive the conformation of the local sugar-phosphate backbone - a quantitative study 1999 Ingår i: JOURNAL OF THE CHEMICAL SOCIETY-PERKIN TRANSACTIONS 1. - : ROYAL SOC CHEMISTRY. - 0300-922X. ; :19, s. 2835-2843 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract The microstructure alteration as a result of cisplatin binding to N7 of guanines in DNA has been herein assessed through the multinuclear temperature-, pH*- and concentration-dependent NMR study of the effect of Pt2+ complexation to 2'-deoxyguanosine 3',5
47.	Puri, N, et al. (författare) How kinetically accessible is an RNA target for hybridization with an antisense oligo? A lesson from an RNA target which is as small as a 20mer 1999 Ingår i: TETRAHEDRON. - : PERGAMON-ELSEVIER SCIENCE LTD. - 0040-4020. ; 55:5, s. 1505-1516 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract A 20 mer RNA (1), characterized as a duplex with two A.A mismatch basepairs and four tandem G.U wobble basepairs, was targeted at the first A.A internal loop by nonameric 5'-Polyarene DNA-conjugates. For comparison, its DNA counterpart (10), which was fou
48.	Puri, N, et al. (författare) Synthesis of 5'-polyarene-tethered oligo-DNAs and the thermal stability and spectroscopic properties of their duplexes and triplexes 1997 Ingår i: TETRAHEDRON. - : PERGAMON-ELSEVIER SCIENCE LTD. - 0040-4020. ; 53:30, s. 10409-10432 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract Eleven different planar hydroxy alkylated polyarenes 1-11 with different geometry, bulk and electronic characteristics were synthesised, and used for tethering to the 5'-phosphate of a 9-mer and a 18-mer DNA sequences through solid-phase synthesis. The 5'
49.	PURI, N, et al. (författare) THE SYNTHESIS AND REACTIVITY OF NEW 2-(N,N-DIISOPROPYLAMINO)-3-METHYLSULFONYL-1,3,2-BENZOXAZAPHOSPHOLES - THE UTILITY OF THE 5-CHLORO ANALOG IN THE ONE-POT SYNTHESIS OF OLIGOTHIOPHOSPHATES - [AP(S)PPA, AP(S)PPPA, PPP5'A2'P(S)5'A, M(7)GP(S)PPA, AP(S)PPPP 1995 Ingår i: TETRAHEDRON. - : PERGAMON-ELSEVIER SCIENCE LTD. - 0040-4020. ; 51:10, s. 2991-3014 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract The synthesis of 2-(N,N-diisopropylamino)-2-3-dihydro-3-methylsulfonyl-1,3,2- benzoxazaphospholes 22, 23 and 24 is reported. Their reactivities have been investigated using a variety of acid catalyst under conditions normally employed in phosphoramidite c
50.	Sandstrom, A, et al. (författare) Determination of the solution conformation of a non-uniformly deuterium labelled (Uppsala 'NMR-window') 21mer RNA hairpin by NMR spectroscopy and computational methods. 1997 Ingår i: NUCLEOSIDES & NUCLEOTIDES. - : MARCEL DEKKER INC. - 0732-8311. ; 16:5-6, s. 743-750 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)abstract The conformation of a 21mer RNA hairpin, 5'-r(AGCCCGCCUAAUGAGCGGGCU)-3, was determined by NMR spectroscopy and computer calculations. The 'Uppsala NMR-window' approach was used to overcome the problem of spectral overlap.

Skapa referenser, mejla, bekava och länka

Länka till träfflistan

Resultat 41-50 av 65

Avgränsa träffmängd

Typ av publikation: tidskriftsartikel (61); recension (3); rapport (1)

Typ av innehåll: övrigt vetenskapligt/konstnärligt (65)Ta bort avgränsningen

Författare/redaktör: Chattopadhyaya, ... (65)Ta bort avgränsningen; Foldesi, A (18); Maltseva, TV (17); Thibaudeau, C (14); Acharya, S (6); Sandstrom, A (6); visa fler...; Zamaratski, E (6); Sund, C (6); Acharya, P (5); Földesi, A (4); Trifonova, A (4); Agback, P (4); Maltseva, T. (3); Matsuda, A (3); Zarytova, VF (3); Kumar, A. (2); Cheruku, P (2); Isaksson, J (2); PAPCHIKHIN, A (2); Ugi, I (2); Denisov, AY (2); Ivanova, EM (2); Bekiroglu, S (2); Altmann, KH (2); Luo, X. (1); Pradeepkumar, P.I. (1); Chatterjee, S (1); Karthick Babu, S (1); Nawrot, B (1); Sprinzl, M (1); Eriksson, S. (1); Werner, B (1); Polak, M (1); Lorenz, K (1); BURKHART, BM (1); SUNDARALINGAM, M (1); Plashkevych, O. (1); Changalov, M M (1); Ivanova, G D (1); Rangelov, M A (1); Minakawa, N (1); Stoineva, I B (1); Yomtova, V M (1); Roussev, C D (1); Petkov, D.D. (1); Domling, A (1); Richter, W (1); Kim, T. K. (1); Pyshnyi, DV (1); Zamaratski, EV (1); visa färre...

Lärosäte: Uppsala universitet (65)Ta bort avgränsningen

Språk: Engelska (65)Ta bort avgränsningen

År

Kungliga biblioteket hanterar dina personuppgifter i enlighet med EU:s dataskyddsförordning (2018), GDPR. Läs mer om hur det funkar här.
Så här hanterar KB dina uppgifter vid användning av denna tjänst.

Copyright © LIBRIS - Nationella bibliotekssystem
LIBRIS.kb.se

pil uppåt

Stäng

Kopiera och spara länken för att återkomma till aktuell vy