31. |
- Domeika, Kristina, et al.
(author)
-
Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
- 2004
-
In: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102
-
Journal article (peer-reviewed)abstract
- The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
|
|
32. |
- Eloranta, Maija-Leena, et al.
(author)
-
A possible mechanism for endogenous activation of the type I interferon system in myositis patients with anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies
- 2007
-
In: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 56:9, s. 3112-3124
-
Journal article (peer-reviewed)abstract
- OBJECTIVE: To investigate type I interferon (IFN) system activation and its correlation with autoantibodies and organ manifestations in polymyositis (PM), dermatomyositis (DM), and inclusion body myositis. METHODS: Sera from 30 patients and 16 healthy controls, or purified IgG, were combined with material released from necrotized cells to stimulate IFNalpha production by peripheral blood mononuclear cells (PBMCs) from healthy blood donors. Muscle biopsy specimens from 25 patients and 7 healthy controls were investigated for blood dendritic cell antigen 2 (BDCA-2)-positive plasmacytoid dendritic cells (PDCs) and IFNalpha/beta-inducible myxovirus resistance 1 (MX-1) protein. RESULTS: Sera from 13 patients who were positive for anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies induced IFNalpha production in PBMCs when combined with necrotic cell material. In addition, IgG prepared from anti-Jo-1-positive PM sera induced IFNalpha with necrotic material, but not when the latter was treated with RNase. BDCA-2 expression in PDCs in muscle tissue was increased in PM patients with anti-Jo-1 autoantibodies, while MX-1 staining in capillaries was increased in DM patients, compared with healthy individuals. IFNalpha-inducing capacity correlated with interstitial lung disease, while MX-1 expression in the capillaries correlated with DM. CONCLUSION: Immune complexes containing anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies and RNA may act as endogenous IFNalpha inducers that activate IFNalpha production in PDCs. These PDCs could be of importance for inducing myositis, whereas in DM patients without autoantibodies the presence of MX-1 protein in capillaries suggests another cellular IFNalpha source and induction mechanism. Consequently, the type I IFN system may be of importance in both PM and DM, but via different pathways.
|
|
33. |
- Eloranta, Maija-Leena, et al.
(author)
-
Cause and consequences of the activated type I interferon system in SLE
- 2016
-
In: Journal of Molecular Medicine. - : Springer Science and Business Media LLC. - 0946-2716 .- 1432-1440. ; 94:10, s. 1103-1110
-
Journal article (peer-reviewed)abstract
- Patients with systemic lupus erythematosus (SLE) have an increased expression of type I interferon (IFN)-regulated genes (an IFN signature), which is caused by an ongoing production of type I IFNs by plasmacytoid dendritic cells (pDCs). The reasons behind the continuous IFN production in SLE are the presence of self-derived IFN inducers and a lack of negative feed-back signals that downregulate the IFN response. In addition, several cells in the immune system promote the IFN production by pDCs and gene variants in the type I IFN signaling pathway contribute to the IFN signature. The type I IFNs act as an immune adjuvant and stimulate T cells, B cells, and monocytes, which all play an important role in the loss of tolerance and persistent autoimmune reaction in SLE. Consequently, new treatments aiming to inhibit the activated type I IFN system in SLE are now being developed and investigated in clinical trials.
|
|
34. |
|
|
35. |
|
|
36. |
- Eloranta, Maija-Leena, et al.
(author)
-
Regulation of the interferon-alpha production induced by RNA-containing immune complexes in plasmacytoid dendritic cells
- 2009
-
In: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 60:8, s. 2418-2427
-
Journal article (peer-reviewed)abstract
- OBJECTIVE: Interferon-alpha (IFNalpha) is produced in several autoimmune diseases, including systemic lupus erythematosus (SLE), and may be important in their pathogenesis. We undertook this study to investigate how IFNalpha production induced by RNA-containing immune complexes (ICs) in plasmacytoid dendritic cells (PDCs) is regulated. METHODS: Normal PDCs purified from peripheral blood mononuclear cells (PBMCs) were cocultivated with other cell populations isolated from healthy individuals or SLE patients. IFNalpha production was induced by RNA-containing ICs, which consisted of anti-RNP autoantibodies and U1 small nuclear RNP particles, and the effects of prostaglandin E2 (PGE2), reactive oxygen species (ROS), or the cytokines IFNalpha2b, granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-10 (IL-10), or tumor necrosis factor alpha (TNFalpha) were explored. RESULTS: Monocytes inhibited IFNalpha production by PDCs in PBMC cultures, while natural killer (NK) cells were stimulatory. The monocytes had little effect on IFNalpha production by pure PDCs but inhibited its stimulation by NK cells. Monocytes from SLE patients were less inhibitory. Exposure of PBMCs or PDCs to IFNalpha2b/GM-CSF increased their IFNalpha production. RNA-containing ICs caused production of ROS, PGE2, and TNFalpha, especially in monocytes. These mediators and IL-10 suppressed IFNalpha production in PBMC cultures, with ROS and PGE2 also inhibiting IFNalpha production by purified PDCs. Inhibition by all of these agents, except for ROS, was abolished by IFNalpha2b/GM-CSF. The inhibitory effect of monocytes was significantly counteracted by the ROS scavengers serotonin and catalase. CONCLUSION: IFNalpha production induced by RNA-containing ICs in PDCs is regulated by a network of interactions between monocytes, NK cells, and PDCs, involving several pro- and antiinflammatory molecules. This should be considered when designing and applying new therapies.
|
|
37. |
- Eloranta, Maija-Leena, et al.
(author)
-
Type I interferon system activation and association with disease manifestations in systemic sclerosis
- 2010
-
In: Annals of the Rheumatic Diseases. - : BMJ. - 0003-4967 .- 1468-2060. ; 69:7, s. 1396-1402
-
Journal article (peer-reviewed)abstract
- OBJECTIVES: To study the presence of interferogenic autoantibodies in systemic sclerosis (SSc) and their correlation with clinical manifestations, serum levels of interferon alpha (IFNalpha) and chemokines of importance in the disease process. METHODS: Peripheral blood mononuclear cells (PBMCs) or purified plasmacytoid dendritic cells (pDCs) from healthy donors were stimulated with sera from patients with SSc (n=70) or healthy individuals (n=30), together with necrotic or apoptotic cell material. The IFNalpha produced and serum levels of IFNalpha, IFN-inducible protein-10 (IP-10)/chemokine (C-X-C motif) ligand 10, monocyte chemoattractant protein-1 (MCP-1)/(C-C motif) ligand-2 (CCL-2), macrophage inflammatory protein-1alpha (MIP-1alpha)/CCL-3 and RANTES/CCL-5 were measured and correlated with the presence of autoantibodies and clinical manifestations in the patients with SSc. RESULTS: Sera from both diffuse SSc and limited SSc contained interferogenic antibodies, which correlated with the presence of anti-ribonucleoprotein and anti-Sjögren syndrome antigen autoantibodies. The pDCs were responsible for the IFNalpha production which required interaction with FcgammaRII and endocytosis. Increased serum levels of IP-10 were associated with vascular manifestations such as cardiac involvement (p=0.027) and pulmonary arterial hypertension (p=0.036). Increased MCP-1 or IFNalpha serum levels were associated with lung fibrosis (p=0.019 and 0.048, respectively). Digital ulcers including digital loss were associated with increased serum levels of IFNalpha (p=0.029). CONCLUSION: An activated type I IFN system previously seen in several other systemic autoimmune diseases is also present in SSc and may contribute to the vascular pathology and affect the profibrotic process.
|
|
38. |
- Emilsson, Össur Ingi, et al.
(author)
-
Different chest HRCT scan protocols change the extent of ground glass opacities
- 2022
-
In: BMC Pulmonary Medicine. - : BioMed Central (BMC). - 1471-2466. ; 22:1
-
Journal article (peer-reviewed)abstract
- BackgroundGround glass opacity (GGO) is the main HRCT feature representing alveolitis in systemic sclerosis-associated interstitial lung disease (SSc-ILD), but may also represent other conditions such as atelectasis or edema. It is unclear how much this is affected by the HRCT scan protocol used. We aimed to compare the performance of three different HRCT protocols to evaluate the degree of SSc-ILD related changes.MethodsEleven patients with SSc underwent chest HRCT scan by three different protocols: First, a supine scan after lying down for 15 minutes, then two scans in alternating order: A prone position scan, and a supine position scan after performing 10 deep breaths using a positive expiratory pressure (PEP) device. The HRCT scans were evaluated by the Warrick score system for ILD-related findings.ResultsThe three HRCT protocols were compared and resulted in different mean (95% CI) Warrick scores: 9.4 (5.3–13.4) in supine after rest; 7.5 (95% CI 3.8–11.1) in prone and 7.6 (95% CI 4.2–11.1) in supine after PEP. When comparing supine after rest to prone and supine after PEP, the latter two scans had a significantly lower score (p = 0.001 for both comparisons). In all cases, only sub-scores for ground glass opacities differed, while sub-scores for fibrosis-related changes did not change.ConclusionsDifferent HRCT scan protocols significantly altered the Warrick severity score for SSc-ILD findings, primarily because of changes in ground glass opacities. These differences may be clinically meaningful.
|
|
39. |
- Enocsson, Helena, et al.
(author)
-
Association of Serum C-Reactive Protein Levels With Lupus Disease Activity in the Absence of Measurable Interferon-α and a C-Reactive Protein Gene Variant
- 2014
-
In: Arthritis & rheumatology (Hoboken, N.J.). - Hoboken, NJ, United States : John Wiley & Sons. - 2326-5191 .- 2326-5205. ; 66:6, s. 1568-1573
-
Journal article (peer-reviewed)abstract
- Objectives: The type I interferon (IFN) system is important in the pathogenesis of systemic lupus erythematosus (SLE). We previously demonstrated an inhibitory effect of IFNα on interleukin 6 (IL-6) induced C-reactive protein (CRP) in vitro, hypothetically explaining the poor correlation between disease activity and CRP levels in SLE. Herein we investigated disease activity, IL-6 and CRP in relation to a CRP gene polymorphism and IFN.Methods: Sera from 155 SLE patients and 100 controls were analyzed for CRP. Patients were genotyped for a CRP single nucleotide polymorphism (rs1205) associated with low CRP levels. Serum IFNα and IL-6 was quantified by immunoassays. Clinical disease activity was assessed by SLE disease activity index 2000 (SLEDAI-2K).Results: CRP levels were increased in SLE patients compared to controls, but were not associated with SLEDAI-2K or IL-6 levels. However, exclusion of patients carrying at least one rs1205 minor allele revealed an association between disease activity and CRP levels (p=0.005). We found a strong association between disease activity and CRP levels (p<0.0005) when patients with measurable IFNα as well as the minor allele of rs1205 where excluded from the analysis. Similarly, when patients with raised IFNα and/or the rs1205 polymorphism were excluded, IL-6 associated with CRP levels.Conclusions: The present study demonstrates that serum IFNα as well as CRP genotype affects the CRP response in SLE patients. Lack of correlation between serum levels of CRP and disease activity could therefore be explained by activation of the type I IFN system and polymorphisms in the CRP gene. © 2014 American College of Rheumatology.
|
|
40. |
- Enocsson, Helena, et al.
(author)
-
C-Reactive Protein Levels in Systemic Lupus Erythematosus Are Modulated by the Interferon Gene Signature and CRP Gene Polymorphism rs1205
- 2021
-
In: Frontiers in Immunology. - : Frontiers Media SA. - 1664-3224. ; 11
-
Journal article (peer-reviewed)abstract
- Objectives: Patients with systemic lupus erythematosus (SLE) often display modest elevations of C-reactive protein (CRP) despite raised disease activity and increased interleukin (IL-) 6. We asked to what extent IL-6 levels, the CRP polymorphism rs1205, and the type I interferon (IFN) gene signature affects the basal CRP levels in patients with SLE during a quiescent phase of the disease. Methods: CRP and IL-6 were analyzed in plasma from 57 patients meeting established classification criteria for SLE. The CRP polymorphism rs1205 was assessed and gene expression analyzed including four type I IFN-regulated genes (IGS). Results: CRP was increased in patients with detectable IL-6 levels (p=0.001) and decreased among IGS-positive subjects (p=0.033). A multiple linear regression model revealed IL-6 to have a positive association with CRP levels, whereas both IGS-positivity and CRP genotype (rs1205) AA/GA were negatively associated with CRP-levels. Conclusion: Our data offer an explanation to the modest CRP levels seen in viral infections and IFN-α driven autoimmunity and corroborate prior observations showing an IFN-α dependent downregulation of CRP. The latter observation, together with the fact that the CRP-lowering polymorphism rs1205 is overrepresented in human SLE, could explain low basal CRP and inadequate CRP-responses among patients with active SLE.
|
|