| 1. |
- Almlöf, Jonas Carlsson, et al.
(författare)
-
Whole-genome sequencing identifies complex contributions to genetic risk by variants in genes causing monogenic systemic lupus erythematosus
- 2019
-
Ingår i: Human Genetics. - : SPRINGER. - 0340-6717 .- 1432-1203. ; 138:2, s. 141-150
-
Tidskriftsartikel (refereegranskat)abstract
- Systemic lupus erythematosus (SLE, OMIM 152700) is a systemic autoimmune disease with a complex etiology. The mode of inheritance of the genetic risk beyond familial SLE cases is currently unknown. Additionally, the contribution of heterozygous variants in genes known to cause monogenic SLE is not fully understood. Whole-genome sequencing of DNA samples from 71 Swedish patients with SLE and their healthy biological parents was performed to investigate the general genetic risk of SLE using known SLE GWAS risk loci identified using the ImmunoChip, variants in genes associated to monogenic SLE, and the mode of inheritance of SLE risk alleles in these families. A random forest model for predicting genetic risk for SLE showed that the SLE risk variants were mainly inherited from one of the parents. In the 71 patients, we detected a significant enrichment of ultra-rare (0.1%) missense and nonsense mutations in 22 genes known to cause monogenic forms of SLE. We identified one previously reported homozygous nonsense mutation in the C1QC (Complement C1q C Chain) gene, which explains the immunodeficiency and severe SLE phenotype of that patient. We also identified seven ultra-rare, coding heterozygous variants in five genes (C1S, DNASE1L3, DNASE1, IFIH1, and RNASEH2A) involved in monogenic SLE. Our findings indicate a complex contribution to the overall genetic risk of SLE by rare variants in genes associated with monogenic forms of SLE. The rare variants were inherited from the other parent than the one who passed on the more common risk variants leading to an increased genetic burden for SLE in the child. Higher frequency SLE risk variants are mostly passed from one of the parents to the offspring affected with SLE. In contrast, the other parent, in seven cases, contributed heterozygous rare variants in genes associated with monogenic forms of SLE, suggesting a larger impact of rare variants in SLE than hitherto reported.
|
|
| 2. |
- Blomberg, Stina, et al.
(författare)
-
Expression of the markers BDCA-2 and BDCA-4 and production of interferon-alpha by plasmacytoid dendritic cells in systemic lupus erythematosus
- 2003
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 48:9, s. 2524-32
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: To study the expression of blood dendritic cell antigen 2 (BDCA-2) and BDCA-4 molecules by plasmacytoid dendritic cells (PDCs) in the blood of patients with systemic lupus erythematosus (SLE), and to study PDC production of interferon-alpha (IFN alpha) and its inhibition by anti-BDCA-2 and anti-BDCA-4 antibodies. METHODS: Peripheral blood mononuclear cells (PBMCs) from SLE patients (SLE PBMCs) and from healthy controls were induced to produce IFN alpha in vitro by SLE serum containing an endogenous IFN alpha-inducing factor (SLE-IIF) or by herpes simplex virus type 1 (HSV-1). The frequencies and numbers of BDCA-2-, BDCA-3-, and BDCA-4-expressing cells were analyzed by flow cytometry, and the effects of anti-BDCA-2 and anti-BDCA-4 monoclonal antibodies (mAb) on IFN alpha production were investigated. RESULTS: IFN alpha production by SLE PBMCs induced by SLE-IIF or HSV-1 was decreased compared with that of healthy control PBMCs (P = 0.002 and P = 0.0007, respectively). The proportions of BDCA-2- and BDCA-3-expressing cells in SLE PBMCs were reduced compared with those in PBMCs from healthy controls (P = 0.01 and P = 0.004, respectively). IFN alpha producers in culture, especially among SLE PBMCs, displayed reduced BDCA-2 expression and constituted only a minority of the BDCA-2-positive cells, at least in healthy control PBMCs (median 18%). IFN alpha production by both SLE and healthy control PBMCs stimulated by SLE-IIF or HSV-1 was markedly reduced by anti-BDCA-2 mAb (median 81-98% inhibition). Anti-BDCA-4 mAb only partially inhibited SLE-IIF-induced IFN alpha production. CONCLUSION: SLE patients had a reduced number of BDCA-2-expressing PDCs, also termed natural IFN alpha-producing cells, and their IFN alpha production could be inhibited by anti-BDCA-2/4 mAb. Such mAb may be a therapeutic option for inhibiting the ongoing IFN alpha production in SLE patients.
|
|
| 3. |
- Bolin, Karin, et al.
(författare)
-
Association of STAT4 Polymorphism with Severe Renal Insufficiency in Lupus Nephritis
- 2013
-
Ingår i: PLOS ONE. - : Public Library of Science. - 1932-6203. ; 8:12, s. 84450-
-
Tidskriftsartikel (refereegranskat)abstract
- Lupus nephritis is a cause of significant morbidity in systemic lupus erythematosus (SLE) and its genetic background has not been completely clarified. The aim of this investigation was to analyze single nucleotide polymorphisms (SNPs) for association with lupus nephritis, its severe form proliferative nephritis and renal outcome, in two Swedish cohorts. Cohort I (n = 567 SLE cases, n = 512 controls) was previously genotyped for 5676 SNPs and cohort II (n = 145 SLE cases, n = 619 controls) was genotyped for SNPs in STAT4, IRF5, TNIP1 and BLK. Case-control and case-only association analyses for patients with lupus nephritis, proliferative nephritis and severe renal insufficiency were performed. In the case-control analysis of cohort I, four highly linked SNPs in STAT4 were associated with lupus nephritis with genome wide significance with p = 3.7x10(-9), OR 2.20 for the best SNP rs11889341. Strong signals of association between IRF5 and an HLA-DR3 SNP marker were also detected in the lupus nephritis case versus healthy control analysis (pless than0.0001). An additional six genes showed an association with lupus nephritis with pless than0.001 (PMS2, TNIP1, CARD11, ITGAM, BLK and IRAK1). In the case-only meta-analysis of the two cohorts, the STAT4 SNP rs7582694 was associated with severe renal insufficiency with p = 1.6x10(-3) and OR 2.22. We conclude that genetic variations in STAT4 predispose to lupus nephritis and a worse outcome with severe renal insufficiency.
|
|
| 4. |
- Båve, Ullvi, et al.
(författare)
-
Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG
- 2003
-
Ingår i: Journal of Immunology. - : American Association of Immunologists. - 0022-1767 .- 1550-6606. ; 171:6, s. 3296-302
-
Tidskriftsartikel (refereegranskat)abstract
- An ongoing production of IFN-alpha may be of etiopathogenic significance in systemic lupus erythematosus (SLE). It may be due to the natural IFN-producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), activated by immune complexes that contain nucleic acids derived from apoptotic cells. We here examined the role of FcgammaR in the IFN-alpha production in vitro by PBMC induced by the combination of apoptotic U937 cells and autoantibody-containing IgG from SLE patients (SLE-IgG). The Fc portion of the SLE-IgG was essential to induce IFN-alpha production, because Fab fragments or F(ab')(2) were ineffective. Normal, especially heat-aggregated, IgG inhibited the IFN-alpha production, suggesting a role for FcgammaR on PBMC. Using blocking anti-FcgammaR Abs, the FcgammaRIIa,c (CD32) but not FcgammaRI or FcgammaRIII were shown to be involved in the IFN-alpha induction by apoptotic cells combined with SLE-IgG, but not by HSV or CpG DNA. In contrast, the action of all of these inducers was inhibited by the anti-FcgammaRIIa,b,c mAb AT10 or heat-aggregated IgG. Flow cytometric analysis revealed that approximately 50% of the BDCA-2-positive PBMC, i.e., NIPC/PDC, expressed low but significant levels of FcgammaRII, as did most of the actual IFN-alpha producers activated by HSV. RT-PCR applied to NIPC/PDC purified by FACS demonstrated expression of FcgammaRIIa, but not of FcgammaRIIb or FcgammaRIIc. We conclude that FcgammaRIIa on NIPC/PDC is involved in the activation of IFN-alpha production by interferogenic immune complexes, but may also mediate inhibitory signals. The FcgammaRIIa could therefore have a key function in NIPC/PDC and be a potential therapeutic target in SLE.
|
|
| 5. |
- Carlsson Almlöf, Jonas, et al.
(författare)
-
Contributions of de novo variants to systemic lupus erythematosus
- 2021
-
Ingår i: European Journal of Human Genetics. - : Springer Nature. - 1018-4813 .- 1476-5438. ; 29:1, s. 184-193
-
Tidskriftsartikel (refereegranskat)abstract
- By performing whole-genome sequencing in a Swedish cohort of 71 parent-offspring trios, in which the child in each family is affected by systemic lupus erythematosus (SLE, OMIM 152700), we investigated the contribution of de novo variants to risk of SLE. We found de novo single nucleotide variants (SNVs) to be significantly enriched in gene promoters in SLE patients compared with healthy controls at a level corresponding to 26 de novo promoter SNVs more in each patient than expected. We identified 12 de novo SNVs in promoter regions of genes that have been previously implicated in SLE, or that have functions that could be of relevance to SLE. Furthermore, we detected three missense de novo SNVs, five de novo insertion-deletions, and three de novo structural variants with potential to affect the expression of genes that are relevant for SLE. Based on enrichment analysis, disease-affecting de novo SNVs are expected to occur in one-third of SLE patients. This study shows that de novo variants in promoters commonly contribute to the genetic risk of SLE. The fact that de novo SNVs in SLE were enriched to promoter regions highlights the importance of using whole-genome sequencing for identification of de novo variants.
|
|
| 6. |
- Carlsson Almlöf, Jonas, et al.
(författare)
-
Novel risk genes for systemic lupus erythematosus predicted by random forest classification
- 2017
-
Ingår i: Scientific Reports. - : Springer Science and Business Media LLC. - 2045-2322. ; 7:1
-
Tidskriftsartikel (refereegranskat)abstract
- Genome-wide association studies have identified risk loci for SLE, but a large proportion of the genetic contribution to SLE still remains unexplained. To detect novel risk genes, and to predict an individual's SLE risk we designed a random forest classifier using SNP genotype data generated on the "Immunochip" from 1,160 patients with SLE and 2,711 controls. Using gene importance scores defined by the random forest classifier, we identified 15 potential novel risk genes for SLE. Of them 12 are associated with other autoimmune diseases than SLE, whereas three genes (ZNF804A, CDK1, and MANF) have not previously been associated with autoimmunity. Random forest classification also allowed prediction of patients at risk for lupus nephritis with an area under the curve of 0.94. By allele-specific gene expression analysis we detected cis-regulatory SNPs that affect the expression levels of six of the top 40 genes designed by the random forest analysis, indicating a regulatory role for the identified risk variants. The 40 top genes from the prediction were overrepresented for differential expression in B and T cells according to RNA-sequencing of samples from five healthy donors, with more frequent over-expression in B cells compared to T cells.
|
|
| 7. |
- Dahlqvist, Johanna, 1979-, et al.
(författare)
-
Identification and functional characterization of a novel susceptibility locus for small vessel vasculitis with MPO-ANCA
- 2022
-
Ingår i: Rheumatology. - Oxford, United Kingdom : Oxford University Press (OUP). - 1462-0324 .- 1462-0332. ; 61:8, s. 3461-3470
-
Tidskriftsartikel (refereegranskat)abstract
- Objective To identify and characterize genetic loci associated with the risk of developing ANCA-associated vasculitides (AAV). Methods Genetic association analyses were performed after Illumina sequencing of 1853 genes and subsequent replication with genotyping of selected single nucleotide polymorphisms in a total cohort of 1110 Scandinavian cases with granulomatosis with polyangiitis or microscopic polyangiitis, and 1589 controls. A novel AAV-associated single nucleotide polymorphism was analysed for allele-specific effects on gene expression using luciferase reporter assay. Results PR3-ANCA(+) AAV was significantly associated with two independent loci in the HLA-DPB1/HLA-DPA1 region [rs1042335, P = 6.3 x 10(-61), odds ratio (OR) 0.10; rs9277341, P = 1.5 x 10(-44), OR 0.22] and with rs28929474 in the SERPINA1 gene (P = 2.7 x 10(-10), OR 2.9). MPO-ANCA(+) AAV was significantly associated with the HLA-DQB1/HLA-DQA2 locus (rs9274619, P = 5.4 x 10(-25), OR 3.7) and with a rare variant in the BACH2 gene (rs78275221, P = 7.9 x 10(-7), OR 3.0), the latter a novel susceptibility locus for MPO-ANCA(+) granulomatosis with polyangiitis/microscopic polyangiitis. The rs78275221-A risk allele reduced luciferase gene expression in endothelial cells, specifically, as compared with the non-risk allele. Conclusion We identified a novel susceptibility locus for MPO-ANCA(+) AAV and propose that the associated variant is of mechanistic importance, exerting a regulatory function on gene expression in specific cell types.
|
|
| 8. |
- Domeika, Kristina, et al.
(författare)
-
Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
- 2004
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102
-
Tidskriftsartikel (refereegranskat)abstract
- The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
|
|
| 9. |
- Enocsson, Helena, et al.
(författare)
-
Association of Serum C-Reactive Protein Levels With Lupus Disease Activity in the Absence of Measurable Interferon-α and a C-Reactive Protein Gene Variant
- 2014
-
Ingår i: Arthritis & rheumatology (Hoboken, N.J.). - Hoboken, NJ, United States : John Wiley & Sons. - 2326-5191 .- 2326-5205. ; 66:6, s. 1568-1573
-
Tidskriftsartikel (refereegranskat)abstract
- Objectives: The type I interferon (IFN) system is important in the pathogenesis of systemic lupus erythematosus (SLE). We previously demonstrated an inhibitory effect of IFNα on interleukin 6 (IL-6) induced C-reactive protein (CRP) in vitro, hypothetically explaining the poor correlation between disease activity and CRP levels in SLE. Herein we investigated disease activity, IL-6 and CRP in relation to a CRP gene polymorphism and IFN.Methods: Sera from 155 SLE patients and 100 controls were analyzed for CRP. Patients were genotyped for a CRP single nucleotide polymorphism (rs1205) associated with low CRP levels. Serum IFNα and IL-6 was quantified by immunoassays. Clinical disease activity was assessed by SLE disease activity index 2000 (SLEDAI-2K).Results: CRP levels were increased in SLE patients compared to controls, but were not associated with SLEDAI-2K or IL-6 levels. However, exclusion of patients carrying at least one rs1205 minor allele revealed an association between disease activity and CRP levels (p=0.005). We found a strong association between disease activity and CRP levels (p<0.0005) when patients with measurable IFNα as well as the minor allele of rs1205 where excluded from the analysis. Similarly, when patients with raised IFNα and/or the rs1205 polymorphism were excluded, IL-6 associated with CRP levels.Conclusions: The present study demonstrates that serum IFNα as well as CRP genotype affects the CRP response in SLE patients. Lack of correlation between serum levels of CRP and disease activity could therefore be explained by activation of the type I IFN system and polymorphisms in the CRP gene. © 2014 American College of Rheumatology.
|
|
| 10. |
- Enocsson, Helena, et al.
(författare)
-
C-Reactive Protein Levels in Systemic Lupus Erythematosus Are Modulated by the Interferon Gene Signature and CRP Gene Polymorphism rs1205
- 2021
-
Ingår i: Frontiers in Immunology. - : Frontiers Media SA. - 1664-3224. ; 11
-
Tidskriftsartikel (refereegranskat)abstract
- Objectives: Patients with systemic lupus erythematosus (SLE) often display modest elevations of C-reactive protein (CRP) despite raised disease activity and increased interleukin (IL-) 6. We asked to what extent IL-6 levels, the CRP polymorphism rs1205, and the type I interferon (IFN) gene signature affects the basal CRP levels in patients with SLE during a quiescent phase of the disease. Methods: CRP and IL-6 were analyzed in plasma from 57 patients meeting established classification criteria for SLE. The CRP polymorphism rs1205 was assessed and gene expression analyzed including four type I IFN-regulated genes (IGS). Results: CRP was increased in patients with detectable IL-6 levels (p=0.001) and decreased among IGS-positive subjects (p=0.033). A multiple linear regression model revealed IL-6 to have a positive association with CRP levels, whereas both IGS-positivity and CRP genotype (rs1205) AA/GA were negatively associated with CRP-levels. Conclusion: Our data offer an explanation to the modest CRP levels seen in viral infections and IFN-α driven autoimmunity and corroborate prior observations showing an IFN-α dependent downregulation of CRP. The latter observation, together with the fact that the CRP-lowering polymorphism rs1205 is overrepresented in human SLE, could explain low basal CRP and inadequate CRP-responses among patients with active SLE.
|
|
