1. |
- Berggren, Olof, et al.
(författare)
-
B lymphocytes enhance the interferon-α production by plasmacytoid dendritic cells
- 2012
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 64:10, s. 3409-3419
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE:Type I interferon (IFN) system and B cells are activated in many autoimmune diseases, e.g. systemic lupus erythematosus (SLE). IFNα produced by plasmacytoid dendritic cells (pDC) stimulate several B cell functions, including autoantibody production. However, not much is known how B cells influence the pDC function. We therefore investigated the regulatory effect of B cells on IFNα production by pDC.METHODS:PDC and B cells from healthy blood donor PBMC were stimulated with RNA-containing immune complexes (RNA-IC) consisting of U1 snRNP and IgG from SLE patients, herpes simplex virus (HSV) or oligonucleotide ODN2216, alone or in co-cultures. IFNα, several other cytokines and pDC or B cell-associated surface molecules were analyzed by immunoassays or flow cytometry.RESULTS:B cells enhanced the IFNα production by pDC up to 47-fold, and the effect was most pronounced for pDC stimulated with RNA-IC. Anti-CD31 antibody reduced the RNA-IC-induced IFNα production by 80%, but not when ODN2216 was used as IFN-inducer. Supernatants from ODN2216-stimulated B cells promoted IFNα production by pDC, while supernatants from RNA-IC-stimulated B cells did not.CONCLUSION: Our results reveal a novel B cell function, enhancing the type I IFN production by pDC. Since B cells are activated by type I IFN, this pDC-B cell cross-talk might be of fundamental importance in the etiopathogenesis of SLE, and contribute to a chronic immune activation in SLE and other systemic rheumatic diseases.
|
|
2. |
|
|
3. |
- Blomberg, Stina, et al.
(författare)
-
Expression of the markers BDCA-2 and BDCA-4 and production of interferon-alpha by plasmacytoid dendritic cells in systemic lupus erythematosus
- 2003
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 48:9, s. 2524-32
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: To study the expression of blood dendritic cell antigen 2 (BDCA-2) and BDCA-4 molecules by plasmacytoid dendritic cells (PDCs) in the blood of patients with systemic lupus erythematosus (SLE), and to study PDC production of interferon-alpha (IFN alpha) and its inhibition by anti-BDCA-2 and anti-BDCA-4 antibodies. METHODS: Peripheral blood mononuclear cells (PBMCs) from SLE patients (SLE PBMCs) and from healthy controls were induced to produce IFN alpha in vitro by SLE serum containing an endogenous IFN alpha-inducing factor (SLE-IIF) or by herpes simplex virus type 1 (HSV-1). The frequencies and numbers of BDCA-2-, BDCA-3-, and BDCA-4-expressing cells were analyzed by flow cytometry, and the effects of anti-BDCA-2 and anti-BDCA-4 monoclonal antibodies (mAb) on IFN alpha production were investigated. RESULTS: IFN alpha production by SLE PBMCs induced by SLE-IIF or HSV-1 was decreased compared with that of healthy control PBMCs (P = 0.002 and P = 0.0007, respectively). The proportions of BDCA-2- and BDCA-3-expressing cells in SLE PBMCs were reduced compared with those in PBMCs from healthy controls (P = 0.01 and P = 0.004, respectively). IFN alpha producers in culture, especially among SLE PBMCs, displayed reduced BDCA-2 expression and constituted only a minority of the BDCA-2-positive cells, at least in healthy control PBMCs (median 18%). IFN alpha production by both SLE and healthy control PBMCs stimulated by SLE-IIF or HSV-1 was markedly reduced by anti-BDCA-2 mAb (median 81-98% inhibition). Anti-BDCA-4 mAb only partially inhibited SLE-IIF-induced IFN alpha production. CONCLUSION: SLE patients had a reduced number of BDCA-2-expressing PDCs, also termed natural IFN alpha-producing cells, and their IFN alpha production could be inhibited by anti-BDCA-2/4 mAb. Such mAb may be a therapeutic option for inhibiting the ongoing IFN alpha production in SLE patients.
|
|
4. |
- Båve, Ullvi, et al.
(författare)
-
Activation of the type I interferon system in primary Sjögren's syndrome : a possible etiopathogenic mechanism
- 2005
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 52:4, s. 1185-1195
-
Tidskriftsartikel (refereegranskat)abstract
- Objective The etiopathogenesis of primary Sjögren's syndrome (SS) is largely unknown. In other autoimmune diseases, type I interferon (IFN) may play a pivotal role by triggering and sustaining the disease process. We therefore aimed to determine whether patients with primary SS had an activated type I IFN system. Methods Salivary gland biopsy specimens and sera from patients with primary SS were investigated for the occurrence of IFNα-producing cells and measurable IFNα levels, respectively. The ability of primary SS sera together with apoptotic or necrotic cells to induce IFNα production in normal peripheral blood mononuclear cells was examined. The IFNα inducer was characterized, and IFNα-producing cells were identified. Clinical data were correlated with the IFNα-inducing capacity of primary SS sera. Results Numerous IFNα-producing cells were detected in salivary gland biopsy specimens, despite low serum IFNα levels. Autoantibodies to RNA-binding proteins, combined with material released by necrotic or late apoptotic cells, were potent inducers of IFNα production in plasmacytoid dendritic cells (PDCs). This appeared to be attributable to RNA-containing immune complexes triggering PDCs by means of RNA and interaction with Fcγ receptor IIa. The IFNα-inducing capacity of sera was associated with positive results of a labial salivary gland biopsy (focus score ≥1) and with dermatologic, hematologic, and pulmonary manifestations. Conclusion Patients with primary SS have an activated type I IFN system. Although virus may initiate the production of IFN, the continued IFNα synthesis is caused by RNA-containing immune complexes that activate PDCs to prolong IFNα production at the tissue level. This IFNα promotes the autoimmune process by a vicious circle–like mechanism, with increased autoantibody production and formation of more endogenous IFNα inducers.
|
|
5. |
|
|
6. |
- Båve, Ullvi, et al.
(författare)
-
Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG
- 2003
-
Ingår i: Journal of Immunology. - : American Association of Immunologists. - 0022-1767 .- 1550-6606. ; 171:6, s. 3296-302
-
Tidskriftsartikel (refereegranskat)abstract
- An ongoing production of IFN-alpha may be of etiopathogenic significance in systemic lupus erythematosus (SLE). It may be due to the natural IFN-producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), activated by immune complexes that contain nucleic acids derived from apoptotic cells. We here examined the role of FcgammaR in the IFN-alpha production in vitro by PBMC induced by the combination of apoptotic U937 cells and autoantibody-containing IgG from SLE patients (SLE-IgG). The Fc portion of the SLE-IgG was essential to induce IFN-alpha production, because Fab fragments or F(ab')(2) were ineffective. Normal, especially heat-aggregated, IgG inhibited the IFN-alpha production, suggesting a role for FcgammaR on PBMC. Using blocking anti-FcgammaR Abs, the FcgammaRIIa,c (CD32) but not FcgammaRI or FcgammaRIII were shown to be involved in the IFN-alpha induction by apoptotic cells combined with SLE-IgG, but not by HSV or CpG DNA. In contrast, the action of all of these inducers was inhibited by the anti-FcgammaRIIa,b,c mAb AT10 or heat-aggregated IgG. Flow cytometric analysis revealed that approximately 50% of the BDCA-2-positive PBMC, i.e., NIPC/PDC, expressed low but significant levels of FcgammaRII, as did most of the actual IFN-alpha producers activated by HSV. RT-PCR applied to NIPC/PDC purified by FACS demonstrated expression of FcgammaRIIa, but not of FcgammaRIIb or FcgammaRIIc. We conclude that FcgammaRIIa on NIPC/PDC is involved in the activation of IFN-alpha production by interferogenic immune complexes, but may also mediate inhibitory signals. The FcgammaRIIa could therefore have a key function in NIPC/PDC and be a potential therapeutic target in SLE.
|
|
7. |
|
|
8. |
- Domeika, Kristina, et al.
(författare)
-
Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
- 2004
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102
-
Tidskriftsartikel (refereegranskat)abstract
- The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
|
|
9. |
- Eloranta, Maija-Leena, et al.
(författare)
-
A possible mechanism for endogenous activation of the type I interferon system in myositis patients with anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies
- 2007
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 56:9, s. 3112-3124
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: To investigate type I interferon (IFN) system activation and its correlation with autoantibodies and organ manifestations in polymyositis (PM), dermatomyositis (DM), and inclusion body myositis. METHODS: Sera from 30 patients and 16 healthy controls, or purified IgG, were combined with material released from necrotized cells to stimulate IFNalpha production by peripheral blood mononuclear cells (PBMCs) from healthy blood donors. Muscle biopsy specimens from 25 patients and 7 healthy controls were investigated for blood dendritic cell antigen 2 (BDCA-2)-positive plasmacytoid dendritic cells (PDCs) and IFNalpha/beta-inducible myxovirus resistance 1 (MX-1) protein. RESULTS: Sera from 13 patients who were positive for anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies induced IFNalpha production in PBMCs when combined with necrotic cell material. In addition, IgG prepared from anti-Jo-1-positive PM sera induced IFNalpha with necrotic material, but not when the latter was treated with RNase. BDCA-2 expression in PDCs in muscle tissue was increased in PM patients with anti-Jo-1 autoantibodies, while MX-1 staining in capillaries was increased in DM patients, compared with healthy individuals. IFNalpha-inducing capacity correlated with interstitial lung disease, while MX-1 expression in the capillaries correlated with DM. CONCLUSION: Immune complexes containing anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies and RNA may act as endogenous IFNalpha inducers that activate IFNalpha production in PDCs. These PDCs could be of importance for inducing myositis, whereas in DM patients without autoantibodies the presence of MX-1 protein in capillaries suggests another cellular IFNalpha source and induction mechanism. Consequently, the type I IFN system may be of importance in both PM and DM, but via different pathways.
|
|
10. |
|
|