1. |
- Lagerberg, Adam, et al.
(författare)
-
Gain Scheduling Design using Feedback Gain Bias Compensation
- 1995
-
Ingår i: The 2nd Russian-Swedish Control Conference, St.\ Petersburg, Russia. - : Control Engineering Laboratory, Chalmers University of Technology, Gothenburg, Sweden.
-
Rapport (övrigt vetenskapligt/konstnärligt)
|
|
2. |
|
|
3. |
|
|
4. |
|
|
5. |
|
|
6. |
- Jemt, Torsten, 1950, et al.
(författare)
-
Accuracy of implant-supported prostheses in the edentulous jaw: analysis of precision of fit between cast gold-alloy frameworks and master casts by means of a three-dimensional photogrammetric technique.
- 1995
-
Ingår i: Clinical Oral Implants Research. - : Wiley. - 0905-7161 .- 1600-0501. ; 6:3, s. 172-80
-
Tidskriftsartikel (refereegranskat)abstract
- Distortions of 15 routine implant-supported prostheses were measured in relation to the master casts after completion by means of a 3-dimensional (3-D) photogrammetric technique. All prostheses were designed as one-piece gold-alloy castings with resin teeth. Five of the prostheses were placed in the edentulous maxilla, and the remaining were placed in the lower jaw. Distortion of the cylinders was mostly observed in the horizontal plane (x- and y-axis) while the vertical aspect seemed to be more stable. The mean 3-D center point distortion was 42 (SD 15) and 74 (SD 38) microns for the upper and lower jaws, respectively. The measurements revealed a range of 3-D center point distortion from 16 to 80 and 15 to 165 microns for the different jaws, respectively. The corresponding 3-D mean angular distortion of the cylinders was 51 (SD 35) microns in lower and 70 (SD 75) microns in the upper jaws. A correlation was found between 3-D center point distortion and the width as well as the curvature of the implant arch, indicating more displacement the wider and the more curved the arch was. The 3-D center point distortion was also significantly higher in the upper jaws which could possibly be explained by the curvature of the implant arch and higher numbers of implants in the upper jaws. Further problems with the fit of upper jaw castings could be related to more alloy in the castings and poor alignment of implants.
|
|
7. |
- Wittung, Pernilla, 1968, et al.
(författare)
-
Fluorescence-detected interactions of oligonucleotides in RecA complexes
- 1995
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 368:1, s. 64-68
-
Tidskriftsartikel (refereegranskat)abstract
- A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA, The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible, The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed, In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur.
|
|
8. |
- Engstrand, Per, et al.
(författare)
-
The impact of chemical addition on refining parameters
- 1995
-
Ingår i: International Mechanical Pulping Conference 1995, Ottawa/St Paul, Canada. - Ottawa, : Ontario Technical Section, CPPA. - 1895288843 ; , s. 281-286
-
Konferensbidrag (övrigt vetenskapligt/konstnärligt)
|
|
9. |
|
|
10. |
- Hansbo, Peter
(författare)
-
Generalized Laplacian smoothing of unstructured grids
- 1995
-
Ingår i: Communications in Numerical Methods in Engineering. - : Wiley. - 1069-8299 .- 1099-0887. ; 11, s. 455-464
-
Tidskriftsartikel (refereegranskat)abstract
- In this note we point out the natural choice of smoothing by use of a metric tenser to maintain control of the local element stretch. The extension to grids on surfaces in 3D is straightforward. Numerical examples are given.
|
|