| 1. |
- Esbjörner, Elin K., et al.
(author)
-
Membrane binding of pH-sensitive Influenza fusion peptides. Positioning, configuration and induced leakage in lipid vesicles models
- 2007
-
In: Biochemistry. - : American Chemical Society (ACS). - 0006-2960 .- 1520-4995. ; 46:47, s. 13490-13504
-
Journal article (peer-reviewed)abstract
- pH-sensitive HA2 fusion peptides from influenza virus hemagglutinin have potential as endosomal escape-inducing components in peptide-based drug delivery. Polarized light spectroscopy and tryptophan fluorescence were used to assess the conformation, orientation, effect on lipid order, and binding kinetics of wild-type peptide HA 1-23) and a glutamic acid-enriched analogue (INF7) in large unilamellar POPC or POPC/POPG (4:1) lipid vesicles (LUVs). pH-sensitive membrane leakage was established for INF7 but not HA2(1-23) using an entrapped-dye assay. A correlation is indicated between leakage and a low degree of lipid chain order (assessed by linear dichroism, LD, of the membrane orientation probe retinoic acid). Both peptides display poor alignment in zwitterionic POPC LUVs compared to POPC/POPG (4:1) LUVs, and it was found that peptide-lipid interactions display slow kinetics (hours), resulting in reduced lipid order and increased tryptophan shielding. At pH 7.4, INF7 displays tryptophan emission and LD features indicative of a surface-orientated peptide, suggesting that its N-terminal glutamic acid residues prevent deep penetration into the hydrocarbon core. At pH 5.0, INF7 displays weaker LD signals, indicating poor orientation, possibly due to aggregation. By contrast, the orientation of the HA2(1-23) peptide backbone supports previously reported oblique insertion (∼60-65° relative to the membrane normal), and aromatic side-chain orientations are consistent with an interfacial (pH-independent) location of the C-terminus. We propose that a conformational change upon reduction of pH is limited to minor rearrangements of the peptide "hinge region" around Trp14 and repositioning of this residue
|
|
| 2. |
- Chiragwandi, Zackary, 1968, et al.
(author)
-
Properties of a bio-photovoltaic nano-device
- 2008
-
In: Journal of Physical Chemistry C. - : American Chemical Society (ACS). - 1932-7447 .- 1932-7455. ; 112:48, s. 18717-18721
-
Journal article (peer-reviewed)abstract
- Properties of an on-chip photovoltaic nanodevice are demonstrated. The dyes comprise green florescent proteins(GFP). Dependence of recently reported zero external potential bias (ZEPB) photocurrent (I) on temperature,power, and wavelength (λ) is shown. Correlation between UV-vis spectrum of the GFP and the ZEPB I(λ)of the device is reported. The temperature dependence suggests the ZEPB photocurrent to reflect a liquidcrystal type ordering where the current declines monotonically with increasing temperature. The influence ofan external bias on the photocurrent is demonstrated. The resulting light-induced current is analyzed in termsof resistive and quantum mechanical contributions.
|
|
| 3. |
- Zhang, X. A., et al.
(author)
-
Dual functions of the human antimicrobial peptide LL-37-Target membrane perturbation and host cell cargo delivery
- 2010
-
In: Biochimica et Biophysica Acta - Biomembranes. - : Elsevier BV. - 1879-2642 .- 0005-2736. ; 1798:12, s. 2201-2208
-
Journal article (peer-reviewed)abstract
- The mechanisms behind target vs. host cell recognition of the human antimicrobial peptide LL-37 remain ill-defined. Here, we have investigated the membrane disruption capacity of LL-37 using large unilamellar vesicles (LUVs) composed of varying mixtures of POPC, POPG and cholesterol to mimic target and host membranes respectively. We show that LL-37 is unable to induce leakage of entrapped calcein from zwitterionic POPC LUVs, whereas leakage from LUVs partially composed of POPG is fast and efficient. In accordance with typical antimicrobial peptide behavior, cholesterol diminished LL-37 induced leakage. By using linear dichroism and flow oriented LUVs, we found that LL-37 orients with the axis of its induced alpha-helix parallel to the membrane surface in POPC:POPG (7:3) LUVs. In the same system, we also observed a time-dependent increase of the parallel alpha-helix LD signal on timescales corresponding to the leakage kinetics. The increased LD may be connected to a peptide translocation step, giving rise to mass balance across the membrane. This could end the leakage process before it is complete, similar to what we have observed. Confocal microscopy studies of eukaryotic cells show that LL-37 is able to mediate the cell delivery of non-covalently linked fluorescent oligonucleotides, in agreement with earlier studies on delivery of plasmid DNA (Sandgren et al., J. Biol. Chem. 279 (2004) 17951). These observations highlight the potential dual functions of LL-37 as an antimicrobial agent against bacterial target cells and a cell-penetrating peptide that can deliver nucleic acids into the host cells.
|
|
| 4. |
- Fredholm, B. B., et al.
(author)
-
Fuels for transportation
- 2010
-
In: Ambio. - : Springer Science and Business Media LLC. - 0044-7447 .- 1654-7209. ; 39:suppl. 1, s. 31-35
-
Journal article (peer-reviewed)abstract
- There is a need to reduce the amount of fossil energy used for transport, both because of the easily available fossil fuel is becoming sparser and because of climate concerns. In this article, the concept of "peak oil" is briefly presented. Second, a practical approach to reduction of fossil fuel use for transport elaborated by two British commissions is presented. A key feature is the introduction of electric cars. This raises the third issue covered in this article: namely, how battery technology is going to meet the increasing needs posed by the transport sector
|
|
| 5. |
- Pradhan, P., et al.
(author)
-
Induced Circular Dichroism of Benzo(a)pyrene-7,8-dihydrodiol 9,10-Epoxide Stereoisomers Covalently Bound to Deoxyribooligonucleotides Used to Probe Equilibrium Distribution between Groove Binding and Intercalative Adduct Conformations
- 1998
-
In: Biochemistry. - : American Chemical Society (ACS). - 1520-4995 .- 0006-2960. ; 37:13, s. 4664-4673
-
Journal article (peer-reviewed)abstract
- Binding conformations of single anti-BPDE-N-2-dG adducts in oligonucleotides of varying base composition have been studied by induced circular dichroism (ICD). The sign of the ICD around 350 nm of single-stranded oligonucleotide adducts and the sign of an exciton type of CD component at 260 nm in both single strand and duplex farms of adducts correlate with the absolute configuration of the cyclohexyl moiety of the adduct. Changes in magnitude and sign of the ICD around 350 nm were observed upon duplex formation. The results show that adducts displaying external (minor groove) binding characteristics are associated with a significant positive ICD. Conversely, adducts displaying intercalation binding characteristics were found to have a positive or negative ICD. The magnitude of the ICD is dependent on the sequence context and the particular adduct isomer studied. Duplexes with (+)-trans-anti-BPDE-N-2-dG in 5'-d(CCTATCGCTATCC) or 5'-d(CCTATAGATATCC) exhibit a relatively strong positive ICD. In contrast, the duplexes with (+)-trans-anti-BPDE-N-2-dG in 5'-d(CCTATTGCTATCC) and 5'-d(CCTATTGTTATCC) display a small positive and negative ICD, respectively, in both cases suggesting conformational heterogeneity. Partially complementary duplexes (dA, dT, or do) localized opposite the (+)-trans-anti-BPDE-N-2-dG adduct in 5'-d(CCTATCGCTATCC) or 5'-d(CCTATAGATATCC) also demonstrated negative ICD. These results together with light absorption characteristics suggest a preferred conformation of intercalation for the mismatched duplexes. Evidence of an equilibrium between the external and intercalative adduct conformation is provided by the results from the temperature dependence of the near-UV absorption and ICD characteristics of (+)-trans-anti-BPDE-N-2-dG complex in a 5'-d(CCTATAGATATCC) duplex.
|
|
| 6. |
- Pradhan, P., et al.
(author)
-
Studies on the Adduct Heterogeneity of Benzo(a)pyrene 7,8-Dihydrodiol 9,10-Epoxide Stereoisomers Covalently Bound to Deoxyribooligonucleotides by Induced Circular Dichroism and Light Absorption Spectroscopy
- 1999
-
In: Chemical Research in Toxicology. - : American Chemical Society (ACS). - 1520-5010 .- 0893-228X. ; 12:5, s. 403-411
-
Journal article (peer-reviewed)abstract
- The binding conformations of single anti- and syn-BPDE-N-2-dG adducts in oligonucleotides of varying base composition have been studied by induced circular dichroism (ICD) and light absorption spectroscopy. The sign of the ICD in single-stranded oligonucleotide adducts correlates with the absolute configuration of the cyclohexyl moiety of the BPDE. Adducts in oligonucleotide duplexes with UV lambda(max) 350 nm exhibiting either positive or negative contributions to the ICD should have intercalated binding as the predominant conformation. The magnitude of the ICD is dependent on the sequence context of the adducted strand and the particular BPDE-adduct isomer under study. In some cases, the results suggest structural heterogeneity. For instance, the (+)- and the (-)-trans-anti-BPDE-N-2-dG adducts in duplexes where a dT flanks the lesion site exhibit weak positive ICD or negative ICD. These results reflect a bimodal conformational adduct distribution with contributions from both externally and internally located adducts. A key observation for the (+)-cis-syn-BPDE-N-2-dG complexes in 5'-d(TGC) and 5'-d(CGC) sequence contexts is that the near-UV absorption spectra showed distinct bands corresponding to minor groove binding (lambda(max) congruent to 346 nm) as well as intercalative binding (lambda(max) congruent to 354 nm). Evidence for an equilibrium between the different modes of localization is provided by the results from the temperature dependence of the near-UV absorption and ICD characteristics of(+)-cis-synBPDE-N-2-dG complexes in 5'-d(TGC) and 5'-d(CGC) sequence contexts, respectively.
|
|
| 7. |
- Sehlstedt, U., et al.
(author)
-
Interactions of the Antiviral Quinoxaline Derivative 9-OH-B220 {2,3-dimethyl-6-(dimethylaminoethyl)-9-hydroxy-6H-indolo-[2,3-b] quinoxaline} with Duplex and Triplex forms of Synthetic DNA and RNA
- 1998
-
In: Journal of Molecular Biology. - : Elsevier BV. - 0022-2836 .- 1089-8638. ; 278:1, s. 31-56
-
Journal article (peer-reviewed)abstract
- The binding of an antiviral quinoxaline derivative, 2,3-dimethyl-6-(dimethylaminoethyl)-9 -hydroxy-6H-indolo-[2,3-b]quinoxaline (9-OH-B220), to synthetic double and triple helical DNA (poly(dA).poly(dT) and poly(dA.)2poly(dT)) and RNA (poly(rA).poly(rU) and poly(rA) .2poly(rU)) has been characterized using flow linear dichroism (LD), circular dichroism (CD), fluorescence spectroscopy, and thermal denaturation. When either of the DNA structures or the RNA duplex serve as host polymers a strongly negative LD is displayed, consistent with intercalation of the chromophoric ring system between the base-pairs/triplets of the nucleic acid structures. Evidence for this geometry also includes weak induced CD signals and strong increments of the fluorescence emission intensities upon binding of the drug to each of these polymer structures. Ln agreement with intercalative binding, 9-OH-B220 is found to effectively enhance the thermal stability of both the double and triple helical states of DNA as well as the RNA duplex. Ln the case of poly(dA).2poly(dT), the drug provides an unusually large stabilization of its triple helical state; upon binding of 9-OH-B220 the tripler-to-duplex equilibrium is shifted towards higher temperature by 52.5 deg. C in a 10 mM sodium cacodylate buffer (pH 7.0) containing 100 mM NaCl and 1 mM EDTA.When triplex RNA serves as host structure, LD indicates that the average orientation angle between the drug chromophore plane and the helix axis of the triple helical RNA is only about 60 to 65 degrees. Moreover, the thermal stabilizing capability, as well as the fluorescence increment, CD inducing power and perturbations of the absorption envelope, of 9-OH-B220 in complex with the RNA tripler are all less pronounced than those observed for the complexes with DNA and duplex RNA. These features indicate binding of 9-OH-B220 in the wide and shallow minor groove of poly(rA).2poly(rU).Based on the present results, some implications for the applications of this low-toxic, antiviral and easily administered drug in an antigene strategy, as well as its potential use as an antiretroviral agent, are discussed
|
|
| 8. |
- Wittung, Pernilla, 1968, et al.
(author)
-
Fluorescence-detected interactions of oligonucleotides in RecA complexes
- 1995
-
In: FEBS Letters. - 1873-3468 .- 0014-5793. ; 368:1, s. 64-68
-
Journal article (peer-reviewed)abstract
- A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA, The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible, The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed, In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur.
|
|
| 9. |
- Coates, C. G., et al.
(author)
-
Picosecond time-resolved resonance Raman probing of the light-switch states of Ru(Phen)(2)dppz (2+)
- 2001
-
In: Journal of Physical Chemistry B. - : American Chemical Society (ACS). - 1520-6106 .- 1520-5207. ; 105:50, s. 12653-12664
-
Journal article (peer-reviewed)abstract
- Picosecond time-resolved resonance Raman (picosecond-TR3) spectroscopy has been used to conduct an extensive photophysical characterization of the light- switch complex [Ru(phen)(2)dppz](2+) as a function of environment, in which studies have been carried out in aqueous and nonaqueous media and in DNA. The results are considered in rotation to a previous report describing environment-sensitive lowest triplet MLCT states. Vibrational marker features and enhancement patterns were used to determine the rapid progression (< 20 ps) between two triplet MLCT states in aqueous environment, followed by subnanosecond, nonradiative deactivation to the ground state. In nonaqueous environment, the long-lived, emissive triplet MLCT state is spectrally identified as the short-lived first triplet MLCT state observed in water, in agreement with the earlier proposed mechanism. The present data are shown to correlate well with previous nanosecond RR findings for the complex in each environment. Interestingly, a precursor state has been identified upon excitation in both nonaqueous solvent and in DNA, which precedes the triplet MLCT state, and the lifetime of which appears to be environment dependent. Observation of this state is discussed in relation to other recent femtosecond spectroscopic studies on this complex.
|
|
| 10. |
- Tuite, E., et al.
(author)
-
Probing DNA conductivity with photoinduced electron transfer and scanning tunneling microscopy
- 2000
-
In: Journal of Biomolecular Structure and Dynamics. - : Informa UK Limited. - 0739-1102 .- 1538-0254. ; , s. 277-283
-
Journal article (peer-reviewed)abstract
- The possibility that the stacked DNA bases can mediate vectorial electron transfer has been examined using two different approaches. Experiments on photoinduced electron transfer with intercalated donors and accepters (either randomly bound or linked dyads of ruthenium complex and viologen) indicate that while DNA may be a better medium than acetonitrile for electron transfer over short distances (2-3-base pair, equivalent to 10-14 Angstrom centre-to-centre separation), it is a poor medium for transport over larger separations. Attempts to measure conductivity of individual DNA molecules using scanning tunneling microscopy to image mixed monolayers of mercaptohexanol (MCH) and 30-mer or 10-mer DNAs with alkanethiol linkers also indicate that DNA in its native state is a poor conductor. AFM images of the DNA/MCH mixed monolayers show that the DNA molecules extend vertically upward from the surface in such surface architectures.
|
|
