1. |
- Aevarsson, A, et al.
(författare)
-
Ligands to the 2Fe iron-sulfur center in succinate dehydrogenase
- 1988
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 232:2, s. 298-302
-
Tidskriftsartikel (refereegranskat)abstract
- Membrane-bound succinate oxidoreductases are flavoenzymes containing one each of a 2Fe, a 3Fe and a 4Fe iron-sulfur center. Amino acid sequence homologies indicate that all three centers are located in the Ip (B) subunit. From polypeptide and gene analysis of Bacillus subtillis succinate dehydrogenase-defective mutants combined with earlier EPR spectroscopic data, we show that four conserved cysteine residues in the first half of Ip are the ligands to the [2Fe-2S] center. These four residues have previously been predicted to be the ligands. Our results also suggest that the N-terminal part of B. subtilis Ip constitutes a domain which can incorporate separately the 2Fe center and interact with Fp, the flavin-containing subunit of the dehydrogenase.
|
|
2. |
|
|
3. |
- Bratt, T, et al.
(författare)
-
Processing and secretion of rat alpha 1-microglobulin-bikunin expressed in eukaryotic cell lines
- 1994
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793. ; 354:1, s. 57-61
-
Tidskriftsartikel (refereegranskat)abstract
- The precursor protein alpha 1-microglobulin-bikunin was cleaved to the same degree whether expressed in CHO cells or in mutated CHO cells, RPE.40 cells, suggested to lack a functional form of the intracellular protease furin. Thus, alpha 1-microglobulin-bikunin probably is not cleaved in vivo by furin. However, simultaneous overexpression of the precursor and furin in COS, CHO and RPE.40 cells increased the cleavage, suggesting that compartmentalisation and concentrations of protease and precursor are important for the cleavage, besides the in vitro specificity. Expression of alpha 1-microglobulin and bikunin alone gave different protein patterns of SDS-PAGE as compared to expression of the precursor and subsequent cleavage, suggesting that the precursor protein is important for the post-translational handling of alpha 1-microglobulin and bikunin.
|
|
4. |
|
|
5. |
|
|
6. |
|
|
7. |
- Hillarp, A, et al.
(författare)
-
Protein S binding in relation to the subunit composition of human C4b-binding protein
- 1989
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793. ; 259:1, s. 6-53
-
Tidskriftsartikel (refereegranskat)abstract
- The human regulatory complement component C4b-binding protein (C4BP) circulates in plasma either as a free protein or in a bimolecular complex with the vitamin K-dependent protein S. The major form of C4BP is composed of 7 identical, disulfide-linked 70 kDa subunits (alpha-chains), the arrangement of which gives the C4BP molecule a spider-like appearance. Recently, we identified a unique 45 kDa subunit (beta-chain) in C4BP. We have now isolated a subpopulation of C4BP, which does not bind protein S. This C4BP species, which had a molecular weight slightly lower than that of the predominant form, was found to lack the beta-chain. Another lower molecular weight form of C4BP was also purified. It contained the beta-chain and was efficient in binding protein S. Its subunit composition was judged to comprise six alpha-chains and one beta-chain. These results indicate C4BP in plasma to be heterogeneous at a molecular level vis-a-vis subunit composition and/or protein S binding ability and provide support for the concept that the beta-chain of C4BP contains the single protein S binding site.
|
|
8. |
- Hägerhäll, Cecilia, et al.
(författare)
-
A structural model for the membrane-integral domain of succinate:quinone oxidoreductases
- 1996
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793.
-
Tidskriftsartikel (refereegranskat)abstract
- Many succinate:quinone oxidoreductases in bacteria and mitochondria, i.e, succinate:quinone reductases and fumarate reductases, contain in the membrane anchor a cytochrome b whose structure and function is poorly understood, Based on biochemical data and polypeptide sequence information, we show that the anchors in different organisms are related despite an apparent diversity in polypeptide and heme composition, A general structural model for the membrane-integral domain of the anchors is proposed, It is an antiparallel four-helix bundle with a novel arrangement of hexa-coordinated protoheme M. The structure can be applied to a larger group of membrane-integral cytochromes of b-type and has evolutionary and functional implications.
|
|
9. |
- Kim, Seog K., et al.
(författare)
-
METHYL GREEN - A DNA MAJOR-GROOVE BINDING-DRUG
- 1993
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 315:1, s. 61-64
-
Tidskriftsartikel (refereegranskat)abstract
- Interaction and binding geometries of complexes of Methyl green with poly(dA-dT)2, poly(dA) . poly(dT), and triplex poly(dA) . 2poly(dT) complexes have been studied by linear dichroism. For both of the complexes with double helical DNAs, the z symmetry axis of Methyl green is found to be approximately parallel to the DNA bases while the x symmetry axis lies at 40-44-degrees relative to the local DNA helix axis, in agreement with a groove binding mode. However, in contrast to minor-groove binders (such as DAPI and Hoechst 33258) Methyl green is found to be excluded from binding to the triple helical poly(dA) . 2poly(dT) in which the major groove is filled by the third strand. While most so far studied groove-binding dyes bind in the minor groove of DNA, Methyl green thus appears to be an exception.
|
|
10. |
|
|
11. |
- Lilja, H., et al.
(författare)
-
Amino acid sequence of the predominant basic protein in human seminal plasma
- 1985
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793. ; 182:1, s. 181-184
-
Tidskriftsartikel (refereegranskat)abstract
- The predominant basic protein in liquefied human seminal plasma is the major degradation product of the gel-forming protein secreted by the seminal vesicles. The amino acid sequence of this basic protein is presented. The basic protein contains 52 amino acid residues. It is devoid of cysteine, methionine, tryptophan, and leucine, but contains seven histidine residues located in the NH2-terminal half of the molecule. The calculated Mr of 5753 is in close agreement with that obtained from gel filtration in guanidine-HCl on Sephacryl S-200(Mr = 6000).
|
|
12. |
|
|
13. |
|
|
14. |
|
|
15. |
- Rahn, Tova, et al.
(författare)
-
Essential role of phosphatidylinositol 3-kinase in insulin-induced activation and phosphorylation of the cGMP-inhibited cAMP phosphodiesterase in rat adipocytes. Studies using the selective inhibitor wortmannin
- 1994
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 350:2-3, s. 314-318
-
Tidskriftsartikel (refereegranskat)abstract
- Incubation of rat adipocytes with wortmannin, a potent and selective phosphatidylinositol 3-kinase (PI 3-kinase) inhibitor, completely blocked the antilipolytic action of insulin (IC50 = 100 nM), the insulin-induced activation and phosphorylation of cGMP-inhibited cAMP phosphodiesterase (cGI-PDE) as well as the activation of the insulin-stimulated cGI-PDE kinase (IC50 = 10-30 nM). No direct effects of the inhibitor on the insulin-stimulated cGI-PDE kinase, the cGI-PDE and the hormone-sensitive lipase were observed. These data suggest that activation of PI 3-kinase upstream of the insulin-stimulated cGI-PDE kinase in the antilipolytic insulin signalchain has an essential role for insulin-induced cGI-PDE activation/phosphorylation and anti-lipolysis.
|
|
16. |
- Smirnova, Irina A., et al.
(författare)
-
HOQNO interaction with cytochrome b in succinate:menaquinone reductase from Bacillus subtilis
- 1995
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 359:1, s. 23-26
-
Tidskriftsartikel (refereegranskat)abstract
- 2-n-Heptyl4-hydroxyquinoline-N-oxide (HOQNO) inhibits the succinate:quinone oxidoreductase activity of isolated and membrane-bound succinate:menaquinone oxidoreductase of B. subtilis. The inhibition pattern resembles closely that observed for α-thenoyltrifluoroacetone and carboxins in the mitochondrial succinate:ubiquinone oxidoreductase: ca. 90% of the activity is highly sensitive to HOQNO (K i ca. 0.2 μM for the isolated enzyme) whereas the rest 10% proves to be resistant to the inhibitor. HOQNO binding is shown to perturb the absorption spectrum of the ferrous di-heme cytochrome b of the B. subtilis succinate:quinone oxidoreductase both in the α and Soret bands. In addition, the inhibitor is shown to bring about a negative shift of E m of the low-potential heme b. It is suggested that HOQNO interacts with a menasemiquinone binding site near the low-potential heme and suppresses the MQ.−-to-MQH2 step of the quinone reductase reaction but allows partly for the MQ-to-MQ.− transition to occur; dismutation of MQ. formed in the latter reaction to MQ and MQH2 may account for the 10% of the enzyme activity insensitive to HOQNO.
|
|
17. |
|
|
18. |
- Takahashi, Masayuki, 1949, et al.
(författare)
-
STRUCTURE OF UVRABC EXCINUCLEASE UV-DAMAGED DNA COMPLEXES STUDIED BY FLOW LINEAR DICHROISM - DNA CURVED BY UVRB AND UVRC
- 1992
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 314:1, s. 10-12
-
Tidskriftsartikel (refereegranskat)abstract
- The interaction between UvrABC excinuclease from Escherichia coli and ultraviolet light- (UV) damaged DNA was studied by flow linear dichroism. The dichroism signal from DNA was drastically decreased in intensity upon incubation with UvrA and UvrB or whole enzyme in the presence of effector ATP. The change was specific for UV-damaged DNA, and a concluded suppressed DNA orientation suggests the wrapping of DNA around the protein. The incubation with the UvrC subunit alone also somewhat reduces the signal, however, in this case the change was smaller and not specific for UV-damaged DNA. The structural modification of DNA, promoted by the (UvrA2-UvrB) complex, probably facilitates or stabilizes the interaction of the UvrC subunit with DNA for the excision.
|
|
19. |
|
|
20. |
- Wieloch, Tadeusz
(författare)
-
Trypsin activation of porcine procolipase. Kinetics of activation and effects on lipid binding
- 1985
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793. ; 185:1, s. 63-66
-
Tidskriftsartikel (refereegranskat)abstract
- The kinetics of trypsin activation of pancreatic procolipase was investigated and the pH dependence of the binding of procolipase and colipase to a tributyrine-bile salt interface studied. The Km was 0.06 mM and Kcat 8 s-1, and was of the same order of magnitude as for the activation of pancreatic zymogens. At basic pH values colipase had a higher affinity for the tributyrine-bile salt interface as compared to procolipase. The trypsin activation of procolipase ensures a rapid degradation of dietary lipids in the intestine.
|
|
21. |
- Abrahamson, Magnus, et al.
(författare)
-
Molecular cloning and sequence analysis of cDNA coding for the precursor of the human cysteine proteinase inhibitor cystatin C
- 1987
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 216:2, s. 229-233
-
Tidskriftsartikel (refereegranskat)abstract
- Recombinant cystatin C producing clones were isolated from a human placenta λgt11 cDNA library. The cDNA insert of one of the clones, containing 777 base pairs, encodes the complete mature cystatin C (120 amino acids) and a hydrophobic leader sequence of 26 amino acids, indicating an extracellular function of the inhibitor. The deduced protein sequence confirms the protein sequence of cystatin C isolated from human urine, but differs in one position from the sequence of the cystatin C fragment deposited as amyloid in hereditary cerebral hemorrhage with amyloidosis.
|
|
22. |
|
|
23. |
|
|
24. |
- Gololobov, Mikhail Yu, et al.
(författare)
-
Organic solvent changes the chymotrypsin specificity with respect to nucleophiles
- 1992
-
Ingår i: FEBS Letters. - 0014-5793. ; 307:3, s. 309-312
-
Tidskriftsartikel (refereegranskat)abstract
- In α-chymotrypsin-catalyzed acyl-transfer reactions in water the specificity of the enzyme (the nucleophile reactivity of amino acid amides) is correlated with the substrate hydrophobicity and increases as the hydrophobicity of the side chain of the amino acid amides is increased. In a low water system (4% H2O) bulky amino acid amides are less efficient nucleophiles. The specificity of α-chymotrypsin towards the amino acid amides in acyl transfer reactions in this case does not depend on the hydrophobicity of the amino acid side chains but correlates with their size. Therefore, different factors can be responsible for the specificity of enzymes in water and in a mainly organic medium.
|
|
25. |
- Hederstedt, Lars, et al.
(författare)
-
Processing of Bacillus subtilis succinate dehydrogenase and cytochrome b-558 polypeptides
- 1987
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 213, s. 385-390
-
Tidskriftsartikel (refereegranskat)abstract
- The DNA sequence of the Bacillus subtilis sdh operon coding for the two succinate dehydrogenase subunits and cytochrome b-558 (the membrane anchor protein) has recently been established. We have now determined the extent of N-terminal processing of each polypeptide by radiosequence analysis. At the same time, direct evidence for the correctness of the predicted reading frames has been obtained. The cytochrome showed a ragged N-terminus, with forms lacking one residue, and is inserted across the membrane without an N-terminal leader-peptide. Covalently bound flavin was not detectable in B. subtilis succinate dehydrogenase expressed in Escherichia coli despite normal N-terminal processing of the apoprotein. This provides an explanation to why the succinate dehydrogenase synthesized in E. coli is not functional and demonstrates that host-specific factors regulate the coenzyme attachment.
|
|
26. |
- Karlsson, Maria, 1985, et al.
(författare)
-
Reconstitution of water channel function of an aquaporin overexpressed and purified from Pichia pastoris.
- 2003
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 537:1-3, s. 68-72
-
Tidskriftsartikel (refereegranskat)abstract
- The aquaporin PM28A is one of the major integral proteins in spinach leaf plasma membranes. Phosphorylation/dephosphorylation of Ser274 at the C-terminus and of Ser115 in the first cytoplasmic loop has been shown to regulate the water channel activity of PM28A when expressed in Xenopus oocytes. To understand the mechanisms of the phosphorylation-mediated gating of the channel the structure of PM28A is required. In a first step we have used the methylotrophic yeast Pichia pastoris for expression of the pm28a gene. The expressed protein has a molecular mass of 32462 Da as determined by matrix-assisted laser desorption ionization-mass spectrometry, forms tetramers as revealed by electron microscopy and is functionally active when reconstituted in proteoliposomes. PM28A was efficiently solubilized from urea- and alkali-stripped Pichia membranes by octyl-beta-D-thioglucopyranoside resulting in a final yield of 25 mg of purified protein per liter of cell culture.
|
|
27. |
|
|
28. |
- Möritz, Annemarie, et al.
(författare)
-
Molecular cloning and sequence analysis of the cDNA encoding the human acrosin-trypsin inhibitor (HUSI-II)
- 1991
-
Ingår i: FEBS Letters. - 0014-5793. ; 278:1, s. 127-130
-
Tidskriftsartikel (refereegranskat)abstract
- A complete cDNA clone encoding the human acrosin-trypsin inhibitor HUSI-II has been isolated from a cDNA library of human testis and completely sequenced. The cDNA of 594 bp contained an open reading frame of 252 base pairs, The deduced amino acid sequence comprised the complete amino acid sequence of HUSI-II[1] and a putative signal peptide. Northern blotting analysis revealed that HUSI-II is synthesized in testis, epididymis and seminal vesicle, but not in the prostate gland.
|
|
29. |
|
|
30. |
- Persson, Daniel, 1972, et al.
(författare)
-
Penetratin-induced Aggregation and Subsequent Dissociation of Negatively Charged Phospholipid Vesicles
- 2001
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 505:2, s. 307-312
-
Tidskriftsartikel (refereegranskat)abstract
- The interaction of the cellular delivery vector penetratin with a model system consisting of negatively charged phospholipid vesicles has been studied. Above a certain peptide to lipid molar ratio, the cationic oligopeptide induces vesicle aggregation. Interestingly, the aggregation is followed by spontaneous disaggregation, which may be related to membrane translocation of the peptide. Circular dichroism (CD) measurements indicate a conformational transition, from alpha -helix to antiparallel beta -pleated sheet, which is simultaneous with the aggregation process. The potential influence of spectroscopic artifacts on CD data due to the drastically increased turbidity during aggregation is discussed.
|
|
31. |
- Pierzchalski, P, et al.
(författare)
-
Synthesis of alpha 1-microglobulin in cultured rat hepatocytes is stimulated by interleukin-6, leukemia inhibitory factor, dexamethasone and retinoic acid
- 1992
-
Ingår i: FEBS Letters. - 0014-5793. ; 298:2-3, s. 8-165
-
Tidskriftsartikel (refereegranskat)abstract
- The secretion of alpha 1-microglobulin by primary cultures of rat hepatocytes was found to increase upon the addition of interleukin-6 or leukemia inhibitory factor, two mediators of acute phase response. This stimulatory effect was further enhanced by dexamethasone. alpha 1-Microglobulin is synthesized as a precursor also containing bikunin, and the precursor protein is cleaved shortly before secretion. Our results therefore suggest that both alpha 1-microglobulin and bikunin are acute phase reactants in rat hepatocytes. Furthermore, we found that retinoic acid, previously shown to be involved in the regulation of cell differentiation and development, also stimulated alpha 1-microglobulin synthesis. Only free, uncomplexed alpha 1-microglobulin (28,000 Da) was detected in the hepatocyte media, suggesting that the complex between alpha 1-microglobulin and alpha 1-inhibitor 3, found in rat serum, is formed outside the hepatocyte.
|
|
32. |
- Rasmusson, Allan G., et al.
(författare)
-
Component of the alternative oxidase localized to the matrix surface of the inner membrane of plant mitochondria
- 1990
-
Ingår i: FEBS Letters. - 0014-5793. ; 259:2, s. 311-314
-
Tidskriftsartikel (refereegranskat)abstract
- In mitoplasts from Arum maculatum spadices, succinate dehydrogenase (EC 1.3.99.1) and the alternative, cyanide-resistant oxidase activity (measured as m-chlorobenzhydroxamic acid-sensitive duroquinol oxidation) was unaffected by treatment with trypsin. In contrast, when 85% inside-out submitochondrial particles were treated with trypsin the alternative oxidase activity was inhibited by about 50% and succinate dehydrogenase activity by about 40%. Thus, a trypsin-sensitive component of the alternative pathway is located on the inner surface of the inner mitochondrial membrane. After trypsin treatment of the inside-out submitochondrial particles the inhibited alternative oxidase activity was partly restored by including 0.7 M citrate in the assay medium. This indicates that trypsin does not destroy the active site but merely causes a conformational change in the enzyme, thereby lowering its activity.
|
|
33. |
- Selmane, T., et al.
(författare)
-
The L2 Loop Peptide of recA Stiffens and restricts Base Motions of Single-stranded DNA Similar to Intact Protein
- 1999
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 446:1, s. 30-34
-
Tidskriftsartikel (refereegranskat)abstract
- The L2 loop in the RecA protein is the catalytic center for DNA strand exchange, Here we investigate the DMA binding properties of the L2 loop peptide using optical spectroscopy with polarized light. Both fluorescence intensity and anisotropy of an etheno-modified poly(dA) increase upon peptide binding, indicate that the base motions of single-stranded DNA are restricted in the complex. In agreement with this conclusion, the peptide-poly(dT) complex exhibits a significant linear dichroism signal. The peptide is also found to modify the structure of double-stranded DNA, but does not denature it. It is inferred that strand separation may not be required for the formation of a joint molecule.
|
|
34. |
- Stenson, Lena, et al.
(författare)
-
Localization of hormone-sensitive lipase to rat Sertoli cells and its expression in developing and degenerating testes
- 1994
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 355:2, s. 125-130
-
Tidskriftsartikel (refereegranskat)abstract
- Using in situ hybridization, hormone-sensitive lipase was found to be expressed in a stage-dependent manner in Sertoli cells of rat testis. No expression was found in Leydig cells but expression in spermatids could not be excluded. These results suggest a role for hormone-sensitive lipase in the metabolism of lipid droplets in Sertoli cells, in contrast to its previously proposed function in steroid biosynthesis. The expression of testicular hormone-sensitive lipase mRNA and protein, both larger in size compared to other tissues, coincided with the onset of spermatogenesis and was dependent on scrotal localization of the testis, suggesting a temperature-dependent, pretranslational regulation of expression.
|
|
35. |
- Struglics, André, et al.
(författare)
-
Protein phosphorylation/dephosphorylation in the inner membrane of potato tuber mitochondria
- 2000
-
Ingår i: FEBS Letters. - 0014-5793. ; 475:3, s. 213-217
-
Tidskriftsartikel (refereegranskat)abstract
- Inside-out inner mitochondrial membranes free of matrix proteins were isolated from purified potato tuber (Solanum tuberosum L.) mitochondria and incubated with [γ-32P]ATP. Proteins were separated by SDS-PAGE and visualized by autoradiography. Phosphorylation of inner membrane proteins, including ATPase subunits, was strongly inhibited by the phosphoprotein phosphatase inhibitor NaF. We propose that an inner membrane phosphoprotein phosphatase is required for activation of the inner membrane protein kinase. When prelabelled inner membranes were incubated in the absence of [γ- 32P]ATP, there was no phosphoprotein dephosphorylation unless a soluble matrix fraction was added. This dephosphorylation was inhibited by NaF, but not by okadaic acid. We conclude that the mitochondrial matrix contains a phosphoprotein phosphatase that is responsible for dephosphorylation of inner membrane phosphoproteins. (C) 2000 Federation of European Biochemical Societies.
|
|
36. |
- Thoren, Per, 1972, et al.
(författare)
-
The Antennapedia peptide penetratin translocates across lipid bilayers - the first direct observation
- 2000
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 482:3, s. 265-268
-
Tidskriftsartikel (refereegranskat)abstract
- The potential use of polypeptides and oligonucleotides for therapeutical purposes has been questioned because of their inherently poor cellular uptake. However, the 16-mer oligopeptide penetratin, derived from the homeodomain of Antennapedia, has been reported to enter cells readily via a non-endocytotic and receptor- and transporter-independent pathway, even when conjugated to large hydrophilic molecules. We here present the first study where penetratin is shown to traverse a pure lipid bilayer. The results support the idea that the uptake mechanism involves only the interaction of the peptide with the membrane lipids. Furthermore, we conclude that the translocation does not involve pore formation.
|
|
37. |
|
|
38. |
- Wittung, Pernilla, 1968, et al.
(författare)
-
Fluorescence-detected interactions of oligonucleotides in RecA complexes
- 1995
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 368:1, s. 64-68
-
Tidskriftsartikel (refereegranskat)abstract
- A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA, The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible, The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed, In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur.
|
|
39. |
- Wittung, Pernilla, 1968, et al.
(författare)
-
Phospholipid membrane permeability of peptide nucleic acid
- 1995
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 365:1, s. 27-29
-
Tidskriftsartikel (refereegranskat)abstract
- Phospholipid vesicles (liposomes) as membrane models have been used to study the penetration properties of peptide nucleic acid (PNA), a new DNA analog in which the nucleobases are attached to a pseudo-peptide backbone, The liposomes were characterised by carboxyfluorescein efflux, light-scattering and cryogenic transmission electron microscopy. The liposome structure was found not to be affected by the incorporation of PNA or an oligonucleotide. Two 10-mer fluorescein-labelled PNAs were found to have low efflux rates (half-times of 5.5 and 11 days), comparable to a 10-mer oligonucleotide (half-time of 7 days). We conclude that passive diffusion of unmodified PNA is not an effective way of transport into biological cells.
|
|
40. |
- Åkerström, B, et al.
(författare)
-
Formation of the alpha 1-microglobulin chromophore in mammalian and insect cells : a novel post-translational mechanism?
- 1995
-
Ingår i: FEBS Letters. - 0014-5793. ; 362:1, s. 4-50
-
Tidskriftsartikel (refereegranskat)abstract
- alpha 1-Microglobulin is an immunosuppressive plasma protein synthesized by the liver. The isolated protein is yellow-brown, but the hypothetical chromophore has not yet been identified. In this work, it is shown that a human liver cell line, HepG2, grown in a completely synthetic and serum-free medium, secretes alpha 1-microglobulin which is also yellow-brown, suggesting a de novo synthesis of the chromophore by the cells. alpha 1-Microglobulin isolated from the culture medium of insect cells transfected with the gene for rat alpha 1-microglobulin is also yellow-brown, suggesting that the gene carries information about the chromophore. Reduction and alkylation or removal of N- or O-linked carbohydrates by glycosidase treatment did not reduce the colour intensity of the protein. An internal dodecapeptide (amino acid positions 70-81 in human alpha 1-microglobulin) was also yellow-brown. The latter results indicate that the chromophore is linked to the polypeptide. In conclusion, the results suggest that the alpha 1-microglobulin gene carries information activating a post-translational protein modification mechanism which is present in mammalian and insect cells.
|
|
41. |
|
|
42. |
- Abdulkarim, Farhad, et al.
(författare)
-
Mutations to kirromycin resistance occur in the interface of domains I and III of EF-Tu.GTP
- 1994
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 352, s. 118-122
-
Tidskriftsartikel (refereegranskat)abstract
- The antibiotic kirromycin inhibits protein synthesis by binding to EF-Tu and preventing its release from the ribosome after GTP hydrolysis.We have isolated and sequenced a collection of kirromycin resistant tuf mutations and identified thirteen single amino acid substitutions at sevendifferent sites in EF-Tu. These have been mapped onto the 3D structures of EF-Tu’GTP and EF-Tu.GDP. In the active GTP form of EF-Tu themutations cluster on each side of the interface between domains I and III. We propose that this domain interface is the binding site for kirromycin.
|
|
43. |
|
|
44. |
|
|
45. |
|
|
46. |
|
|
47. |
|
|
48. |
|
|
49. |
- Bläckberg, Lars, et al.
(författare)
-
Bile salt-stimulated lipase in human milk. Evidence that bile salt induces lipid binding and activation via binding to different sites.
- 1993
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 323:3, s. 207-210
-
Tidskriftsartikel (refereegranskat)abstract
- Human milk bile salt-stimulated lipase ensures efficient triacylglycerol utilization in breast-fed newborns. For activity against long-chain triacylglycerol, primary bile salts are a prerequisite. Bile salts also protect the enzyme from inactivation by intestinal proteases. We have studied the effect of different bile salts on activation, protease protection, lipid binding, and enzyme inactivation, caused by an arginine modifying agent. Based on the results we propose a model involving two bile salt binding sites; one activation-site specific for primary bile salt, and another, less specific, lipid binding promoting site at which also secondary bile salt binds. Binding to this latter site induces binding of enzyme to emulsified substrates but binding promoting site at which also secondary bile salt binds. Binding to this latter site induces binding of enzyme to emulsified substrates but without subsequent lipolysis.
|
|
50. |
|
|