| 1. |
- Ahlberg, Viktor, et al.
(författare)
-
Global transcriptional response to ISCOM-Matrix adjuvant at the site of administration and in the draining lymph node early after intramuscular injection in pigs
- 2012
-
Ingår i: Developmental and Comparative Immunology. - : Elsevier BV. - 0145-305X .- 1879-0089. ; 38, s. 17-26
-
Tidskriftsartikel (refereegranskat)abstract
- ISCOM vaccines induce a balanced Th1/Th2 response, long-lasting antibody responses and cytotoxic T lymphocytes. The mode of action for the adjuvant component, the ISCOM-Matrix, is known to some extent but questions remain regarding its mechanism of action. The Affymetrix GeneChip (R) Porcine Genome Array was applied to study the global transcriptional response to ISCOM-Matrix in pigs at the injection site and in the draining lymph node 24 h after i.m. injection. Gene enrichment analysis revealed inflammation, innate immunity and antigen processing to be central in the ISCOM-Matrix response. At the injection site, 594 genes were differentially expressed, including up-regulation of the cytokines osteopontin (SPP1), IL-10 and IL-18 and the chemokines CCL2, CCL19 and CXCL16. Of the 362 genes differentially expressed in the lymph node, IL-1 beta and CXCL11 were up-regulated whereas IL18, CCL15 and CXCL12 were down-regulated. ISCOM-Matrix also modulated genes for pattern recognition receptors at the injection site (TLR2, TLR4, MRC1, PTX3, LGALS3) and in the lymph node (TLR4, RIG-I, MDA5, OAS1, ElF2AK2, LGALS3). A high proportion of up-regulated interferon-regulated genes indicated an interferon response. Thus, several genes, genetic pathways and biological processes were identified that are likely to shape the early immune response elicited by ISCOM-based vaccines. (C) 2012 Elsevier Ltd. All rights reserved.
|
|
| 2. |
- Ahlberg, Viktor, et al.
(författare)
-
Global transcriptional response to ISCOM matrix at the site of administration and in draining lymph nodes after intramuscular injection in pigs
- 2011
-
Annan publikation (övrigt vetenskapligt/konstnärligt)abstract
- ISCOM vaccines are characterised by a balanced Th1/Th2 response and induction of CTLs. The adjuvant component, ISCOM-matrix, consists of purified saponins, cholesterol and phospholipids. However, the mode of action for the ISCOM-matrix is still largely unknown, especially concerning its modulation of gene expression in the innate immunity. To address this, the early global transcriptional response to ISCOM-matrix was studied in pigs. ISCOM-matrix, Matrix M (AbISCO® 100), was given as intramuscular injection and the Affymetrix GeneChip® Porcine Genome Array was applied to analyse gene expression at the injection site and in the draining lymph node after 24 hours. A total of 594 and 362 genes were differentially expressed (fold change > 2; q < 0.05) at the injection site and in the lymph node, respectively. At the injection site, the cytokines osteopontin (SPP1), IL-10 and IL-18 and the chemokines CCL2, CCL19 and CXCL16 were up-regulated. In the draining lymph node, IL-1β and CXCL11 were up-regulated but IL18, CCL15 and CXCL12 were down-regulated. AbISCO® 100 also modulated genes for several pattern recognition receptors at the injection site (TLR2, TLR4, MRC1, PTX3) and in the draining lymph node (TLR4, RIG-I, MDA5, OAS1, PRKR). Furthermore, a strong interferon induction was indicated; 54.3 % (n = 50) and 28.1 % (n = 108) of the up-regulated genes in the lymph node and at the injection site, respectively, were identified as interferon-regulated genes, of which several are known to be involved in host response to pathogens. In conclusion, ISCOM-matrix, without any antigen added, has a clear immunomodulatory effect at the site of administration as well as in the draining lymph node. These findings could help to reveal yet unknown mechanisms for how the ISCOM-matrix and ISCOMs mediate their adjuvant activity
|
|
| 3. |
- Ahlberg, Viktor, et al.
(författare)
-
Innate immune responses induced by the saponin adjuvant Matrix-M in specific pathogen free pigs
- 2017
-
Ingår i: Veterinary Research. - : Springer Science and Business Media LLC. - 0928-4249 .- 1297-9716. ; 48
-
Tidskriftsartikel (refereegranskat)abstract
- Saponin-based adjuvants have been widely used to enhance humoral and cellular immune responses in many species, but their mode of action is not fully understood. A characterization of the porcine transcriptional response to Matrix-M was performed in vitro using lymphocytes, monocytes or monocyte-derived dendritic cells (MoDCs) and in vivo. The effect of Matrix-M was also evaluated in specific pathogen free (SPF) pigs exposed to conventionally reared pigs. The pro-inflammatory cytokine genes IL1B and CXCL8 were up-regulated in monocytes and lymphocytes after Matrix-M exposure. Matrix-M also induced IL12B, IL17A and IFNG in lymphocytes and IFN-a gene expression in MoDCs. Several genes were indicated as up-regulated by Matrix-M in blood 18 h after injection, of which the genes for IFN-a and TLR2 could be statistically confirmed. Respiratory disease developed in all SPF pigs mixed with conventional pigs within 1-3 days. Two out of four SPF pigs injected with saline prior to contact exposure displayed systemic symptoms that was not recorded for the four pigs administered Matrix-M. Granulocyte counts, serum amyloid A levels and transcription of IL18 and TLR2 coincided with disease progression in the pigs. These results support further evaluation of Matrix-M as a possible enhancer of innate immune responses during critical moments in pig management.
|
|
| 4. |
|
|
| 5. |
- Andersson, Märit, et al.
(författare)
-
Intestinal gene expression in pigs experimentally co-infected with PCV2 and PPV
- 2011
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier BV. - 0165-2427 .- 1873-2534. ; 142, s. 72-80
-
Tidskriftsartikel (refereegranskat)abstract
- The objective of the present study was to characterize the local immune reaction in the intestine of pigs experimentally infected with PCV2 and PPV. Archived intestinal material from an experimental study in which pigs were co-infected with a Swedish isolate of PCV2 (S-PCV2) and PPV, or a reference isolate of PCV2 (PCV2-1010) and PPV, were used. The intestinal samples were analysed by qPCR for expression of a number of selected cytokines and the overall gene expression in the intestine was screened by cDNA microarray. Analyses by qPCR showed that pigs infected with PCV2-1010/PPV displayed a significantly increased mRNA expression for IL-6 (p < 0.05), IL-10 (p < 0.05) and IFN-gamma (p < 0.05). The microarray screening revealed a strong up-regulation of IFITM3 along with several other interferon-stimulated genes (ISGs) in pigs infected with PCV2/PPV. The analyses also indicated differences between the two isolates. Fewer pigs infected with S-PCV2/PPV expressed the cytokines detected by qPCR, compared to pigs infected with PCV2-1010/PPV, and pigs infected with S-PCV2/PPV displayed a higher proportion of down-regulated genes than PCV2-1010/PPV-infected pigs. (C) 2011 Elsevier B.V. All rights reserved.
|
|
| 6. |
|
|
| 7. |
|
|
| 8. |
|
|
| 9. |
- Blomström, Anne-Lie, et al.
(författare)
-
Characterisation of the Virome of Tonsils from Conventional Pigs and from Specific Pathogen-Free Pigs
- 2018
-
Ingår i: Viruses. - : MDPI AG. - 1999-4915. ; 10
-
Tidskriftsartikel (refereegranskat)abstract
- Porcine respiratory disease is a multifactorial disease that can be influenced by a number of different microorganisms, as well as by non-infectious factors such as the management and environment of the animals. It is generally believed that the interaction between different infectious agents plays an important role in regard to respiratory diseases. Therefore, we used high-throughput sequencing combined with viral metagenomics to characterise the viral community of tonsil samples from pigs coming from a conventional herd with lesions in the respiratory tract at slaughter. In parallel, samples from specific pathogen-free pigs were also analysed. This study showed a variable co-infection rate in the different pigs. The differences were not seen at the group level but in individual pigs. Some viruses such as adenoviruses and certain picornaviruses could be found in most pigs, while others such as different parvoviruses and anelloviruses were only identified in a few pigs. In addition, the complete coding region of porcine parvovirus 7 was obtained, as were the complete genomes of two teschoviruses. The results from this study will aid in elucidating which viruses are circulating in both healthy pigs and in pigs associated with respiratory illness. This knowledge is needed for future investigations into the role of viral-viral interactions in relation to disease development.
|
|
| 10. |
- Blomström, Anne-Lie, et al.
(författare)
-
Detection of a novel porcine boca-like virus in the background of porcine circovirus type 2 induced postweaning multisystemic wasting syndrome
- 2009
-
Ingår i: Virus Research. - : Elsevier BV. - 0168-1702 .- 1872-7492. ; 146, s. 125-129
-
Tidskriftsartikel (refereegranskat)abstract
- Porcine circovirus type 2 (PCV-2) has been found to be the causative agent of postweaning multisystemic wasting syndrome (PMWS). However, PCV-2 is a ubiquitous virus in the swine population and a majority of pigs infected with PCV-2 do not develop the disease. Different factors such as age, maintenance, the genetics of PCV-2, other pathogens, etc. have been suggested to contribute to the development of PMWS. However, so far no proven connection between any of these factors and the disease development has been found. In this study we explored the possible presence of other so far unknown DNA containing infectious agents in lymph nodes collected from Swedish pigs with confirmed PMWS through random amplification and high-throughput sequencing. Although the vast majority of the amplified genetic sequences belonged to PCV-2, we also found genome sequences of Torque Teno virus (TTV) and of a novel parvovirus. The detection of TTV was expected since like PCV-2, TTV has been found to have high prevalence in pigs around the world. We were able to amplify a longer region of the parvovirus genome, consisting of the entire NP1 and partial VP1/2. By comparative analysis of the nucleotide sequences and phylogenetic studies we propose that this is a novel porcine parvovirus, with genetic relationship to bocaviruses. (C) 2009 Elsevier B.V. All rights reserved.
|
|
| 11. |
- Blomström, Anne-Lie, et al.
(författare)
-
Studies of porcine circovirus type 2, porcine boca-like virus and torque teno virus indicate the presence of multiple viral infections in postweaning multisystemic wasting syndrome pigs
- 2010
-
Ingår i: Virus Research. - : Elsevier BV. - 0168-1702 .- 1872-7492. ; 152, s. 59-64
-
Tidskriftsartikel (refereegranskat)abstract
- In a previous study, using random amplification and large-scale sequencing technology, we identified a novel porcine parvovirus belonging to the genus Bocavirus in the background of porcine circovirus type 2 (PCV-2) in Swedish pigs with postweaning multisystemic wasting syndrome (PMWS). In addition to bocavirus we demonstrated the presence of torque teno virus (TTV) genogroups 1 and 2 in these cases of PMWS, indicating the simultaneous presence of several viruses in this disease complex. In the present study, 34 PMWS-affected animals and 24 pigs without PMWS were screened by PCR for the presence of PCV-2, TTV-1, TTV-2 and porcine boca-like virus (Pbo-likeV). The studies revealed the following infection rates in the PMWS-affected pigs: PCV-2 100%, TTV-1 77%, TTV-2 94% and Pbo-likeV 88%. In comparison. the pigs without PMWS had the following rates: PCV-2 80%, TTV-1 79%, TTV-2 83% and Pbo-likeV 46%. The sequence identity between the different Swedish Pbo-likeV sequences ranged between 98% and 100%. By checking co-infection, it was found that 71% of the PMWS-affected pigs harbor simultaneously all these viruses. As a contrast, in the group without PMWS only 33% of the animals were positive simultaneously for these viruses. These observations indicate a multiple viral infection in PMWS-affected pigs. It has to be studied further if the clinical manifestation of PMWS might be due to synergistic effects of different viruses acting together. (C) 2010 Elsevier B.V. All rights reserved.
|
|
| 12. |
- Blomström, Anne-Lie, et al.
(författare)
-
Viral Metagenomic Analysis Displays the Co-Infection Situation in Healthy and PMWS Affected Pigs
- 2016
-
Ingår i: PLoS ONE. - : Public Library of Science (PLoS). - 1932-6203. ; 11
-
Tidskriftsartikel (refereegranskat)abstract
- The development of high-throughput sequencing technologies have allowed the possibility to investigate and characterise the entire microbiome of individuals, providing better insight to the complex interaction between different microorganisms. This will help to understand how the microbiome influence the susceptibility of secondary agents and development of disease. We have applied viral metagenomics to investigate the virome of lymph nodes from Swedish pigs suffering from the multifactorial disease postweaning multisystemic wasting syndrome (PMWS) as well as from healthy pigs. The aim is to increase knowledge of potential viruses, apart from porcine circovirus type 2 (PCV2), involved in PMWS development as well as to increase knowledge on the virome of healthy individuals. In healthy individuals, a diverse viral flora was seen with several different viruses present simultaneously. The majority of the identified viruses were small linear and circular DNA viruses, such as different circoviruses, anelloviruses and bocaviruses. In the pigs suffering from PMWS, PCV2 sequences were, as expected, detected to a high extent but other viruses were also identified in the background of PCV2. Apart from DNA viruses also RNA viruses were identified, among them were a porcine pestivirus showing high similarity to a recently (in 2015) discovered atypical porcine pestivirus in the US. Majority of the viruses identified in the background of PCV2 in PMWS pigs could also be identified in the healthy pigs. PCV2 sequences were also identified in the healthy pigs but to a much lower extent than in PMWS affected pigs. Although the method used here is not quantitative the very clear difference in amount of PCV2 sequences in PMWS affected pigs and healthy pigs most likely reflect the very strong replication of PCV2 known to be a hallmark of PMWS. Taken together, these findings illustrate that pigs appear to have a considerable viral flora consisting to a large extent of small single-stranded and circular DNA viruses. Future research on these types of viruses will help to better understand the role that these ubiquitous viruses may have on health and disease of pigs. We also demonstrate for the first time, in Europe, the presence of a novel porcine pestivirus.
|
|
| 13. |
- Domeika, Kristina, et al.
(författare)
-
Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
- 2004
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102
-
Tidskriftsartikel (refereegranskat)abstract
- The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
|
|
| 14. |
- Edfors-Lilja, Inger, et al.
(författare)
-
Genetic variation in Con A induced interleukin 2 production by porcine blood mononuclear cells
- 1991
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier BV. - 0165-2427 .- 1873-2534. ; 27:4, s. 351-363
-
Tidskriftsartikel (refereegranskat)abstract
- Genetic variation in concanavalin A (Con A)-induced proliferation and interleukin 2 (IL-2) production by peripheral blood mononuclear cells (PBMC) was studied in blood collected from 96 piglets, a aged 7 weeks. The piglets were the offspring of seven sires and 24 dams. Pronounced differences between litters from various dams were observed in the immune parameters measured. Also, large individual differences in the magnitudes of Con A-induced proliferation and IL-2 production were seen for PBMC collected from individual pigs within each litter. Both the time course and magnitude of IL-2 activity showed genetic variation, as results from the offspring of the seven sires differed significantly. However, only the time course, not the magnitude, of proliferation differed among the offspring groups. It was possible to establish a rank order for the sires based on the IL-2 production of PBMC by their offspring. As IL-2 has a key role in regulating the immune response, mitogen-induced IL-2 activity seems to be a good candidate as a general marker for cell-mediated immunity in pigs.
|
|
| 15. |
|
|
| 16. |
|
|
| 17. |
|
|
| 18. |
- Fossum, Caroline, et al.
(författare)
-
Dynamics of serum antibodies to and load of porcine circovirus type 2 (PCV2) in pigs in three finishing herds, affected or not by postweaning multisystemic wasting syndrome
- 2010
-
Ingår i: Acta Veterinaria Scandinavica. - : Springer Science and Business Media LLC. - 0044-605X .- 1751-0147. ; 52
-
Tidskriftsartikel (refereegranskat)abstract
- Background: Despite that PMWS commonly affects pigs aged eight to sixteen weeks; most studies of PMWS have been conducted during the period before transfer to finishing herds. This study focused on PCV2 load and antibody dynamics in finishing herds with different PMWS status.Methods: Sequentially collected blood samples from 40 pigs in each of two Swedish (A and B) and one Norwegian (C) finishing herds were analysed for serum PCV2-load and -antibodies and saliva cortisol. The two Swedish herds differed in PMWS status, despite receiving animals from the same sow pool (multi-site production). However, the PMWS-deemed herd (A) had previously also received pigs from the spot market. ResultsThe initial serum PCV2 load was similar in the two Swedish herds. In herd A, it peaked after two weeks in the finishing herd and a high number of the pigs had serum PCV2 levels above 10(7) per ml. The antibody titres increased continually with exception for the pigs that developed PMWS, that had initially low and then declining antibody levels. Pigs in the healthy herd B also expressed high titres of antibodies to PCV2 on arrival but remained at that level throughout the study whereas the viral load steadily decreased. No PCV2 antibodies and only low amounts of PCV2 DNA were detected in serum collected during the first five weeks in the PMWS-free herd C. Thereafter a peak in serum PCV2 load accompanied by an antibody response was recorded. PCV2 from the two Swedish herds grouped into genotype PCV2b whereas the Norwegian isolate grouped into PCV2a. Cortisol levels were lower in herd C than in herds A and B.Conclusions: The most obvious difference between the Swedish finishing herds and the Norwegian herd was the time of infection with PCV2 in relation to the time of allocation, as well as the genotype of PCV2. Clinical PMWS was preceded by low levels of serum antibodies and a high load of PCV2 but did not develop in all such animals. It is notable that herd A became affected by PMWS after errors in management routine, emphasising the importance of proper hygiene and general disease-preventing measures.
|
|
| 19. |
- Fossum, Caroline, et al.
(författare)
-
Early inflammatory response to the saponin adjuvant Matrix-M in the pig
- 2014
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier BV. - 0165-2427 .- 1873-2534. ; 158, s. 53-61
-
Tidskriftsartikel (refereegranskat)abstract
- The early inflammatory response to Matrix-M was evaluated in pigs. Adverse reactions measured as body temperature, appetite, activity level and reaction at the site of injection were not observed after s.c. injection with three doses of the adjuvant (75, 100 or 150 mu g) into one week old piglets. Analyses of the immediate cytokine response of PBMC after in vitro exposure to Matrix-M (AbISCO-100 (R)) revealed only a low expression of mRNA for tumour necrosis factor-alpha (p < 0.05) after 6 h incubation. Histological examination revealed an infiltration of leukocytes, haemorrhage and necrosis in muscle 24 h after i.m. injection of 150 mu g Matrix-M in pigs aged eleven weeks. At this time, different grades of reactive lymphoid hyperplasia were recorded in the draining lymph node that was enlarged in three of these six pigs injected with Matrix-M. The global transcriptional response at the site of injection and in the draining lymph node was analyzed using Affymetrix GeneChip Porcine Genome Array. A significant enrichment of gene signatures for the cell types described as "myeloid cells" and "plasmacytoid dendritic cells" was observed at the site of injection in Matrix-M injected pigs compared with pigs injected with saline. A number of genes encoding cytokines/chemokines or their receptors were upregulated at the injection site as well as in the draining lymph node. In the draining lymph node, a majority of the upregulated genes were interferon-regulated genes (IRGs). The expression of IFN-beta, but not IFN-alpha, was increased in the draining lymph nodes of a majority of the pigs exposed to Matrix-M. These IFN-beta expressing pigs also expressed increased levels of osteopontin (OPN) or stimulator of interferon genes (STING), two factors known to facilitate the expression of type I IFNs in response to viral infection. Thus, Matrix-M does not appear to induce any harmful inflammatory response in piglets whilst contributing to the innate immunity by activating the type I IFN system, possibly through several alternative signalling pathways. (C) 2013 Elsevier B.V. All rights reserved.
|
|
| 20. |
- Fossum, Caroline, et al.
(författare)
-
Expression of tlr4, md2 and cd14 in equine blood leukocytes during endotoxin infusion and in intestinal tissues from healthy horses
- 2012
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier BV. - 0165-2427 .- 1873-2534. ; 150:3-4, s. 141-148
-
Tidskriftsartikel (refereegranskat)abstract
- The expression of tlr4, md2 and cd14 was studied in equine blood leukocytes and in intestinal samples using real time PCR. The stability of three commonly used reference genes, glyceraldehyde-3P-dehydrogenase (GAPDH), hypoxantine ribosyltransferase (HPRT) and succinate dehydrogenase complex subunit A (SDHA), was evaluated using qbase(PLUS). The equine peripheral blood mononuclear cells (eqPBMC) examined were either stimulated in vitro with Phorbol 12-myristate 13-acetate (PMA) and ionomycin or with the CpG oligodeoxynuclotide 2216 (CpG-ODN 2216) or obtained from horses before, during and after infusion of endotoxin. Intestinal tissue from healthy horses was sampled at ileum, right dorsal colon and rectum. Ranking of the three reference genes used for normalisation identified the combination HPRT/SDHA as most suitable both when determined ex vivo in leukocytes obtained from experimentally induced endotoxaemia and in eqPBMC activated in vitro while HPRT/GAPDH were most appropriate for the intestinal samples. The relative amounts of mRNA for TLR4 and MD-2 increased threefold during in vitro activation of the cells with CpG-ODN 2216 but was decreased in cultures stimulated with PMA/ionomycin. A transient elevation in the transcription of tlr4 and md2 was also evident for equine blood leukocytes following endotoxaemia. The levels of mRNA for CD14 on the other hard remained unaffected both during the induction of endotoxaemia and in the in vitro stimulated PBMCs. A low steady expression of TLR4, MD-2 and CD14 mRNA was demonstrated for the intestinal samples with no variation between the intestinal segments analysed. Thus, the foundation for real time PCR based levels of analysis of mRNA for all three components in the equine LPS receptor complex in different intestinal segments was set, making it possible to carry out future expression studies on clinical material.
|
|
| 21. |
- Fossum, Caroline
(författare)
-
Immune responses and vaccine-induced immunity against Porcine circovirus type 2
- 2010
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier BV. - 0165-2427 .- 1873-2534. ; 136, s. 185-193
-
Forskningsöversikt (refereegranskat)abstract
- Porcine circovirus type 2 (PCV2) is essential but not sufficient for postweaning multi-systemic wasting syndrome (PMWS) occurrence in pigs. The outcome of PCV2 infection depends on the specific immune responses that are developing during the infection. Diseased pigs are immunosupressed and unable to mount effective immune responses to clear the virus from circulation. In the final stage, PMWS-affected pigs suffer from extensive lymphoid lesions and altered cytokine expression patterns in peripheral blood mononuclear cells (PBMCs) and lymphoid organs. PCV2 infection can also be asymptomatic, demonstrating that not every infection will guarantee the occurrence of severe immunopathological disturbances. Asymptomatic animals have higher virus specific and neutralising antibody titres than PMWS-affected animals. Recent results have pointed out that the mechanisms by which PCV2 can affect the immune responses involve the induction of IL-10, virus accumulation into and modulation of plasmacytoid dendritic cells and the role of viral DNA in regulation of immune cell functions. Fourteen years after the first description of PMWS in Canada, efficient commercial vaccines against PCV2 are available. The vaccine success is based on activated humoral and cellular immune responses against PCV2. This review focuses on the recent research on immunological aspects during PCV2 infections and summarizes what is currently known about the vaccine-induced immunity. (C) 2010 Elsevier B.V. All rights reserved.
|
|
| 22. |
- Fossum, Caroline, et al.
(författare)
-
PCV2 on the spot-A new method for the detection of single porcine circovirus type 2 secreting cells
- 2014
-
Ingår i: Journal of Virological Methods. - : Elsevier BV. - 0166-0934 .- 1879-0984. ; 196, s. 185-192
-
Tidskriftsartikel (refereegranskat)abstract
- A porcine circovirus type 2 SPOT (PCV2-SPOT) assay was established to enumerate virus-secreting lymphocytes obtained from naturally infected pigs. The assay is based on the same principle as general ELISPOT assays but instead of detecting cytokine or immunoglobulin secretion, PCV2 particles are immobilized and detected as filter spots. The method was used to evaluate the influence of various cell activators on the PCV2 secretion in vitro and was also applied to study the PCV2 secretion by lymphocytes obtained from pigs in healthy herds and in a herd afflicted by postweaning multisystemic wasting disease (PMWS). Peripheral blood mononuclear cells (PBMCs) obtained from a pig with severe PMWS produced PCV2-SPOT5 spontaneously whereas PBMCs obtained from pigs infected subclinically only generated PCV2-SPOT5 upon in vitro stimulation. The PCV2 secretion potential was related to the PCV2 DNA content in the PBMCs as determined by two PCV2 real-time PCR assays, developed to differentiate between Swedish PCV2 genogroups 1 (PCV2a) and 3 (PCV2b). Besides the current application these qPCRs could simplify future epidemiological studies and allow genogroup detection/quantitation in dual infection experiments and similar studies. The developed PCV2-SPOT assay offers a semi-quantitative approach to evaluate the potential of PCV2-infected porcine cells to release PCV2 viral particles as well as a system to evaluate the ability of different cell types or compounds to affect PCV2 replication and secretion. (C) 2013 Elsevier B.V. All rights reserved.
|
|
| 23. |
|
|
| 24. |
- Hasslung Wikström, Frida, et al.
(författare)
-
Cytokine induction by immunostimulatory DNA in porcine PBMC is impaired by a hairpin forming sequence motif from the genome of Porcine Circovirus type 2 (PCV2)
- 2011
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier BV. - 0165-2427 .- 1873-2534. ; 139, s. 156-166
-
Tidskriftsartikel (refereegranskat)abstract
- The effect of ODN PCV2/1 was studied further by monitoring the expression of mRNA for IFN-alpha, IL-12p40, IL-10, IL-6, IFN-gamma, IL-1 beta, TGF-beta, and TNF-alpha in cultures of poPBMC stimulated with ODN 2216 or Poly I:C. Results from qPCR analyses showed that ODN PCV2/1 clearly inhibited the expression of IFN-alpha, IL-12p40, IL-10 and IL-6 when induced by ODN 2216, but did not seem to affect any of the cytokines examined when induced by Poly I:C. Initial studies using confocal microscopy and fluorochrome labelled ODNs indicate that ODN 2216 and ODN PCV2/1 co-localize in subpopulations of poPBMC. (C) 2010 Elsevier B.V. All rights reserved.
|
|
| 25. |
|
|
| 26. |
- Hellman, Stina, et al.
(författare)
-
Cytokine responses to various larval stages of equine strongyles and modulatory effects of the adjuvant G3 in vitro
- 2020
-
Ingår i: Parasite Immunology. - : Wiley. - 0141-9838 .- 1365-3024. ; 43
-
Tidskriftsartikel (refereegranskat)abstract
- Aims To generate different larval stages ofStrongylus vulgarisand to study cytokine responses in cultures of eqPBMC exposed to defined larval stages ofS. vulgarisand cyathostomins with the aim to understand the early immune reaction to these parasites. Methods and results EqPBMC were exposed toS. vulgarislarvae (L3, exsheated L3 and L4) and cyathostomin L3 and analysed for cytokine gene expression. Procedures for decontamination, culturing and attenuation of larvae were established. Transcription of IL-4, IL-5 and IL-13 was induced by bothS. vulgarisand cyathostomin L3. Moulting ofS. vulgarisfrom L3 to L4 stage was accompanied by a shift to high expression of IL-5 and IL-9 (exsheated L3 and L4) and IFN-gamma (L4 only). In parallel, the adjuvant G3 modified the cytokine profile induced by both parasites by reducing the expression of IL-4, IL-5 and IL-10 while concomitantly enhancing the expression of IFN-gamma. Conclusion The L4 stage ofS. vulgarisgenerated a cytokine profile different from that induced by the earlier L3 stage ofS. vulgarisand cyathostomins. This diversity depending on the life cycle stage will have implications for the choice of antigen and adjuvant in future vaccine design.
|
|
| 27. |
- Hellman, Stina, et al.
(författare)
-
Equine enteroid-derived monolayers recapitulate key features of parasitic intestinal nematode infection
- 2024
-
Ingår i: Veterinary research (Print). - : Springer Nature. - 0928-4249 .- 1297-9716. ; 55:1
-
Tidskriftsartikel (refereegranskat)abstract
- Stem cell-derived organoid cultures have emerged as attractive experimental models for infection biology research regarding various types of gastro-intestinal pathogens and host species. However, the large size of infectious nematode larvae and the closed structure of 3-dimensional organoids often hinder studies of the natural route of infection. To enable easy administration to the apical surface of the epithelium, organoids from the equine small intestine, i.e. enteroids, were used in the present study to establish epithelial monolayer cultures. These monolayers were functionally tested by stimulation with IL-4 and IL-13, and/or exposure to infectious stage larvae of the equine nematodes Parascaris univalens, cyathostominae and/or Strongylus vulgaris. Effects were recorded using transcriptional analysis combined with histochemistry, immunofluorescence-, live-cell- and scanning electron microscopy. These analyses revealed heterogeneous monolayers containing both immature and differentiated cells including tuft cells and mucus-producing goblet cells. Stimulation with IL-4/IL-13 increased tuft- and goblet cell differentiation as demonstrated by the expression of DCLK1 and MUC2. In these cytokine-primed monolayers, the expression of MUC2 was further promoted by co-culture with P. univalens. Moreover, live-cell imaging revealed morphological alterations of the epithelial cells following exposure to larvae even in the absence of cytokine stimulation. Thus, the present work describes the design, characterization and usability of an experimental model representing the equine nematode-infected small intestinal epithelium. The presence of tuft cells and goblet cells whose mucus production is affected by Th2 cytokines and/or the presence of larvae opens up for mechanistic studies of the physical interactions between nematodes and the equine intestinal mucosa.
|
|
| 28. |
- Hellman, Stina, et al.
(författare)
-
The adjuvant G3 promotes a Th1 polarizing innate immune response in equine PBMC
- 2018
-
Ingår i: Veterinary Research. - : Springer Science and Business Media LLC. - 0928-4249 .- 1297-9716. ; 49
-
Tidskriftsartikel (refereegranskat)abstract
- The immunomodulatory effect of a new particulate adjuvant, G3, alone or in combination with agonists to TLR2/1 or TLR5 was evaluated in cultures of equine PBMC. Exposure to the G3 adjuvant up-regulated genes encoding IFN-, IL-1, IL-6, IL-8, IL-12p40 and IL-23p19 in the majority of the horses tested, indicating that the G3 adjuvant induced a pro-inflammatory and Th1 dominated profile. In accordance, genes encoding IL-13, IL-4, IL-10 and TGF- remained unaffected and genes encoding IFN-, IL-17A and TNF- were only occasionally and weakly induced. The two TLR agonists Pam3CSK4 (TLR2/1) and FliC (TLR5) induced cytokine profiles characterized by a clear induction of IL-10 as well as up-regulation of the genes encoding IL-1, IL-6 and IL-8. The presence of G3 modified this response, in particular by reducing the FliC and Pam3CSK4 induced production of IL-10. Furthermore, G3 acted in synergy with Pam3CSK4 in enhancing the production of IFN- whereas G3 combined with FliC increased the gene expression of IL-8. Thus, the G3 adjuvant seems to have the capacity to promote a Th1 polarizing innate immune response in eqPBMC, both by favouring IFN- production and by reducing production of IL-10 induced by co-delivered molecules. These features make G3 an interesting candidate to further evaluate for its potential as an adjuvant in equine vaccines.
|
|
| 29. |
- Henriksson, Sara, et al.
(författare)
-
Development of an in situ assay for simultaneous detection of the genomic and replicative form of PCV2 using padlock probes and rolling circle amplification
- 2011
-
Ingår i: Virology Journal. - 1743-422X. ; 8, s. 37-
-
Tidskriftsartikel (refereegranskat)abstract
- Background: In this study we utilized padlock probes and rolling circle amplification as a mean to detect and study the replication of porcine circovirus type 2 (PCV2) in cultured cells and in infected tissue. Porcine circovirus type 2 is a single-stranded circular DNA virus associated with several severe diseases, porcine circovirus diseases (PCVD) in pigs, such as postweaning multisystemic wasting syndrome. The exact reason and mechanisms behind the trigger of PCV2 replication that is associated with these diseases is not well-known. The virus replicates with rolling circle replication and thus also exists as a double-stranded replicative form. Results: By applying padlock probes and rolling circle amplification we could not only visualise the viral genome but also discriminate between the genomic and the replicative strand in situ. The genomic strand existed in higher numbers than the replicative strand. The virus accumulated in certain nuclei but also spread into the cytoplasm of cells in the surrounding tissue. In cultured cells the average number of signals increased with time after infection. Conclusions: We have developed a method for detection of both strands of PCV2 in situ that can be useful for studies of replication and in situ detection of PCV2 as well as of DNA viruses in general.
|
|
| 30. |
- Hjertner, Bernt, et al.
(författare)
-
A novel adjuvant G3 induces both Th1 and Th2 related immune responses in mice after immunization with a trivalent inactivated split-virion influenza vaccine
- 2018
-
Ingår i: Vaccine. - : Elsevier BV. - 0264-410X .- 1358-8745. ; 36, s. 3340-3344
-
Tidskriftsartikel (refereegranskat)abstract
- A preferred adjuvant should promote both Th1 and Th2 responses. However, most adjuvants in common use are biased towards a Th2-driven response. Therefore, the ability of a novel saponin-based adjuvant G3 to inducing balanced Thl and Th2 responses in BALB/c mice immunized with a split trivalent seasonal influenza vaccine was evaluated in comparison to that of the adjuvant Al(OH) 3 . Clear differences in the IgG profiles induced by G3, Al(OH)(3) or non-adjuvanted vaccine were recorded. Both adjuvants enhanced high and similar levels of the Th2 associated IgG1 subtype compared to mice given vaccine alone. Only G3 enhanced the IgG2a subclass reflecting a Th1 response, whereas Al(OH)(3) even abrogated the IgG2a production. Accordingly, G3 enhanced the production of IL-2 and IFN-gamma and also of IL-2/IFN-gamma double secreting cells, emphasizing the strong Th1 driving effect of G3. Only Al(OH)(3) increased splenocyte production of IL-17. Taken together, the results indicate a strong propensity for G3 to induce both Th1 and Th2 driven immune responses. (C) 2018 The Authors. Published by Elsevier Ltd.
|
|
| 31. |
- Hjertner, Bernt, et al.
(författare)
-
Development of a 3-transcript host expression assay to differentiate between viral and bacterial infections in pigs
- 2021
-
Ingår i: PLoS ONE. - : Public Library of Science (PLoS). - 1932-6203. ; 16
-
Tidskriftsartikel (refereegranskat)abstract
- Indiscriminate use of antibiotics to treat infections that are of viral origin contributes to unnecessary use which potentially may induce resistance in commensal bacteria. To counteract this a number of host gene transcriptional studies have been conducted to identify genes that are differently expressed during bacterial and viral infections in humans, and thus could be used as a tool to base decisions on the use of antibiotics. In this paper, we aimed to evaluate the potential of a selection of genes that have been considered biomarkers in humans, to differentially diagnose bacterial from viral infections in the pig. First porcine PBMC were induced with six toll-like receptor (TLR) agonists (FliC, LPS, ODN 2216, Pam3CSK4, poly I:C, R848) to mimic host gene expression induced by bacterial or viral pathogens, or exposed to heat-killed Actinobacillus pleuropneumoniae or a split influenza virus. Genes that were differentially expressed between bacterial and viral inducers were further evaluated on clinical material comprising eleven healthy pigs, and six pigs infected with A. pleuropneumoniae. This comprised three virally upregulated genes (IFI44L, MxA, RSAD2) and four bacterially upregulated genes (IL-1 beta, IL-8, FAM89A, S100PBP). All six infected pigs could be differentially diagnosed to healthy pigs using a host gene transcription assay based on the geometric average of the bacterially induced genes IL-8 and S100PBP over that of the virally induced gene MxA.
|
|
| 32. |
- Hjertner, Bernt, et al.
(författare)
-
Expression of reference genes and T helper 17 associated cytokine genes in the equine intestinal tract
- 2013
-
Ingår i: Veterinary Journal. - : Elsevier BV. - 1090-0233 .- 1532-2971. ; 197, s. 817-823
-
Tidskriftsartikel (refereegranskat)abstract
- There is accumulating evidence for the involvement of pro-inflammatory cytokines associated with a T helper 17 response in intestinal disorders such as inflammatory bowel disease (IBD) in humans. The involvement of interleukin (IL)-17 or IL-23 in equine IBD has not been studied and most gene expression studies in the equine intestine have been limited to the use of a single non-validated reference gene. In this study, expression of the reference gene candidates beta(2) microglobulin (beta 2M), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), histone H2A type I, hypoxanthine-guanine phosphoribosyltransferase (HPRT), 60S ribosomal protein L32 (RPL32), succinate dehydrogenase complex subunit A (SDHA) and transferrin receptor I protein coding (TFRC) in the equine intestine was evaluated by quantitative PCR. Three to four reference genes were adequate for normalisation of gene expression in the healthy duodenum, mid-jejunum, colon and rectum, although each segment required a unique combination of reference genes. No combination of the evaluated genes was optimal for the caecum and ileum. Another combination of reference genes (GAPDH, HPRT, RPL32 and SDHA) was optimal for normalisation of rectal samples from healthy and IBD-affected horses, indicating that reference genes should be re-evaluated if material from diseased specimens is analysed. Basal expression of IL-12p40, IL-17A and IL-23p19 was detected in each segment, which will enable gene expression studies of these cytokines by relative quantification. (C) 2013 Elsevier Ltd. All rights reserved.
|
|
| 33. |
- Jacobson, Magdalena, et al.
(författare)
-
Microarray and cytokine analyses of field cases of pigs with diarrhoea
- 2011
-
Ingår i: Veterinary Microbiology. - : Elsevier BV. - 0378-1135 .- 1873-2542. ; 153, s. 307-314
-
Tidskriftsartikel (refereegranskat)abstract
- This field study explored the cytokine expression in intestinal tissue and serum from 19 diarrhoeic and 9 healthy pigs in herds with a long-time history of Lawsonia intracellularis-infection. The disease, proliferative enteropathy (PE), is associated with diarrhoea and poor performance in growers and haemorrhagic diarrhoea and sudden death in finisher pigs, but the immunopathology is poorly understood. Histopathology, demonstration of L intracellularis and porcine circovirus type 2 (PCV2) in intestinal tissue by PCR, and detection of serum antibodies to L. intracellularis, were performed. The presence of IL-1 beta, IL-6, IL-10, IFN-alpha, IFN-gamma, TNF-alpha and TGF-beta in sera was determined by immunoassays, and intestinal mRNA expression of these cytokines plus IL-12p40 was determined by qPCR. Intestinal specimens from pigs with intestinal adenomatosis (n = 2), proliferative haemorrhagic enteropathy or swine dysentery (n = 2), and controls (n = 2) were analysed by a genome wide porcine microarray. The clinical signs of PE were not always supported by the subsequent analyses, and the presence of PCV2 may have contributed to an increased mRNA expression for IFN-gamma in intestinal specimens from some pigs. The limited gene expression in the microarray analyses and the limited expression of cytokines in both sera and intestines, indicate that the immune response is poorly activated in the initial course of an infection with L. intracellularis. However, the gene encoding for insulin-like growth factor binding protein 3 (IGFBP-3) was up-regulated in two pigs with prominent mucosal proliferation. (C) 2011 Elsevier B.V. All rights reserved.
|
|
| 34. |
- Jiwakanon, Jatesada, et al.
(författare)
-
Cytokine expression in the gilt oviduct: Effects of seminal plasma, spermatozoa and extender after insemination
- 2010
-
Ingår i: Animal Reproduction Science. - : Elsevier BV. - 0378-4320 .- 1873-2232. ; 119, s. 244-257
-
Tidskriftsartikel (refereegranskat)abstract
- Effects of semen components [fresh semen in extender, spermatozoa in extender (Spz), seminal plasma (SP)], or extender alone (Beltsville thawing solution, BTS) on the expression of selected cytokines [interleukin (IL)-1 beta, IL-6, IL-10 and transforming growth factor (TGF)-beta 1)] as well as the presence of cells positive for CD8 or CD25 were studied in the pig oviduct. In addition, cytokines in SP and oviductal flushings were analyzed.In experiment (Exp) I, groups of gilts were sampled at 5-6 h after insemination with SP, Spz, fresh semen in BTS or only BTS (control). In Exp II, gilts were sampled 35-40 h after insemination with SP, Spz, BTS or only catheter insertion (control).Most oviductal flushing samples were positive (detectable limits) for IL-10 and TGF-beta 1 but only few for IL-6. The IHC-labelling of IL-6. IL-10 and TGF-beta 1 was evident, especially in the epithelial cells of the isthmus and infundibulum as well as in the cells of the regional (mesometrial) lymph node. Cilia of the epithelium were positive for IL-6 (strongest in the infundibulum) and TGF-beta 1 (strongest in the isthmus) but negative for IL-10. There were no consistent differences in IHC-labelling of the cytokines in relation to different treatments, except at 35-40 h after insemination (Exp II), when IL-6 was slightly higher in epithelium of the SP group and IL-10 in the infundibular connective tissue was higher in the SP and Spz groups.In the isthmus and infundibulum, there were no differences between animals inseminated with BTS (control) and the semen components for any of the cytokine mRNAs at 5-6 h after insemination (Exp I). However, later (35-40 h, Exp II), insemination with SP, Spz and BTS alone appeared to up-regulate TGF-beta 1 mRNA expression compared with the control group (without any fluid infused). In all treatment groups, the mRNA level for TGF-beta 1 was higher than for IL-1 beta, IL-6 and IL-10. Higher mRNA levels of all cytokines were found in the isthmus compared with the infundibulum.Numbers of CD8-positive cells (both in epithelium and connective tissue) appeared higher in the infundibulum compared with the isthmus and were mostly higher shortly (Exp I) after treatment with SP, SPZ and BTS than later (Exp II) in both segments. CD25-positive cells were few and found solely in the sub-epithelial connective tissue.The results indicate that in the porcine oviduct, IL-6. IL-10 and TGF-beta 1 are endogenous produced and that TGF-beta 1 may have a more important role for immunomodulation than the other cytokines, especially in isthmus. Differences between isthmus and infundibulum in cytokine mRNA expression and in presence of CD8-positive cells indicate different patterns of immune reactivity in the upper and lower parts of the oviduct. (C) 2010 Elsevier B.V. All rights reserved.
|
|
| 35. |
|
|
| 36. |
- Kruse, Robert, 1972-, et al.
(författare)
-
Blood concentrations of the cytokines IL-1beta, IL-6, IL-10, TNF-alpha and IFN-gamma during experimentally induced swine dysentery
- 2008
-
Ingår i: Acta Veterinaria Scandinavica. - : BioMed Central. - 0044-605X .- 1751-0147. ; 50
-
Tidskriftsartikel (refereegranskat)abstract
- BACKGROUND: Knowledge of the cytokine response at infection with Brachyspira hyodysenteriae can help understanding disease mechanism involved during swine dysentery. Since this knowledge is still limited the aim of the present study was to induce dysentery experimentally in pigs and to monitor the development of important immunoregulatory cytokines in blood collected at various stages of the disease.METHODS: Ten conventional pigs (~23 kg) were orally inoculated with Brachyspira hyodysenteriae B204T. Eight animals developed muco-haemorrhagic diarrhoea with impaired general body condition. Blood was sampled before inoculation and repeatedly during acute dysentery and recovery periods and cytokine levels of IL-1beta, IL-6, Il-10, TNF-alpha and IFN-gamma were measured by ELISA.RESULTS: IL-1beta was increased at the beginning of the dysentery period and coincided with the appearance of Serum amyloid A and clinical signs of disease. TNF-alpha increased in all animals after inoculation, with a peak during dysentery, and IL-6 was found in 3 animals during dysentery and in the 2 animals that did not develop clinical signs of disease. IL-10 was found in all sick animals during the recovery period. IFN-gamma was not detected on any occasion.CONCLUSION: B. hyodysenteriae inoculation induced production of systemic levels of IL-1beta during the dysentery period and increased levels of IL-10 coincided with recovery from dysentery.
|
|
| 37. |
- Nostell, Katarina, et al.
(författare)
-
Lipopolysaccharide-induced inhibition of transcription of tlr4 in vitro is reversed by dexamethasone and correlates with presence of conserved NF kappa B binding sites
- 2013
-
Ingår i: Biochemical and Biophysical Research Communications. - : Elsevier BV. - 0006-291X .- 1090-2104. ; 432, s. 256-261
-
Tidskriftsartikel (refereegranskat)abstract
- Engagement of Toll-like receptor 4 (TLR4) by lipopolysaccharide (LPS) is a master trigger of the deleterious effects of septic shock. Horses and humans are considered the most sensitive species to septic shock, but the mechanisms explaining these phenomena remain elusive. Analysis of tlr4 promoters revealed high similarity among LPS-sensitive species (human, chimpanzee, and horse) and low similarity with LPS-resistant species (mouse and rat). Four conserved nuclear factor kappa B (NF kappa B) binding sites were found in the tlr4 promoter and two in the md2 promoter sequences that are likely to be targets for dexamethasone regulation. In vitro treatment of equine peripheral blood mononuclear cells (eqPBMC) with LPS decreased transcripts of tlr4 and increased transcription of md2 (myeloid differentiation factor 2) and cd14 (cluster of differentiation 14). Treatment with dexamethasone rescued transcription of tlr4 after LPS inhibition. LPS-induced transcription of md2 was inhibited in the presence of dexamethasone. Dexamethasone alone did not affect transcription of tlr4 and md2. (C) 2013 Elsevier Inc. All rights reserved.
|
|
| 38. |
|
|
| 39. |
- Olofsson, Karin, et al.
(författare)
-
Expression of T helper type 17 (Th17)-associated cytokines and toll-like receptor 4 and their correlation with Foxp3 positive cells in rectal biopsies of horses with clinical signs of inflammatory bowel disease
- 2015
-
Ingår i: Veterinary Journal. - : Elsevier BV. - 1090-0233 .- 1532-2971. ; 206, s. 97-104
-
Tidskriftsartikel (refereegranskat)abstract
- Inflammatory bowel disease (IBD) in horses is an idiopathic disorder, encompassing different types of chronic intestinal inflammation. The pathogenesis of the disease remains to be established, but it has been suggested that an imbalance between regulatory T cells (Tregs) and T helper 17 (Th17)-associated cytokines and altered toll-like receptor 4 (TLR4) expression is associated with intestinal inflammation in other species. The aim of the present study was to quantify Tregs in rectal biopsies from horses affected with IBD by immunohistochemistry and to evaluate expression of genes encoding interleukin (IL)-12p40, IL-17A, IL-23p19 and TLR4 by real-time quantitative PCR.Rectal biopsies from 11 healthy horses and 11 horses with clinical signs of IBD, showing inflammation classified as chronic simple proctitis (CSP) or chronic active simple proctitis (CASP), were evaluated. Expression of IL-17A mRNA was greater in horses affected with CASP compared with horses with CSP or healthy horses. In contrast, expression of IL-12p40 was lower in horses with CSP compared with horses with CASP or healthy horses. TLR4 expression was greater in horses with CASP compared with healthy horses. A positive correlation was seen between the numbers of Tregs and expression of IL-17A and IL-23p19. An association was demonstrated between the histopathological pattern of inflammation, cytokine profile and number of infiltrating Tregs. The research findings suggest that Th17 cells are involved in active IBD, possibly through recruitment of neutrophils via IL-17A, in combination with inadequate suppression of the inflammatory response by Tregs. (C) 2015 Elsevier Ltd. All rights reserved.
|
|
| 40. |
- Sjölund, Marie, et al.
(författare)
-
Effects of different antimicrobial treatments on serum acute phase responses and leucocyte counts in pigs after a primary and a secondary challenge infection with Actinobacillus pleuropneumoniae
- 2011
-
Ingår i: Veterinary Record. - : Wiley. - 0042-4900 .- 2042-7670. ; 169
-
Tidskriftsartikel (refereegranskat)abstract
- The susceptibility to an initial challenge and a re-challenge inoculation with Actinobacillus pleuropneumoniae was analysed in pigs that were treated with antimicrobials of different efficacies following the first exposure to A pleuropneumoniae. In brief, 30 nine-week-old specific pathogen-free pigs were allocated to five groups of six. After acclimatisation, four groups were inoculated with A pleuropneumoniae serotype 2. At the onset of clinical signs, three of the groups of pigs were treated with enrofloxacin, tetracycline or penicillin. A fourth group served as the inoculated control and the fifth group as a control group that had not been inoculated. On day 28, all five groups were re-challenged with the same strain of A pleuropneumoniae serotype 2 as had been used in the first inoculation. No treatments were carried out at this time. The acute phase responses and differential leucocyte counts were monitored in detail after both inoculations. Leucocytosis and acute phase responses in the forms of serum amyloid A, pig-major acute phase protein and haptoglobin were recorded in all of the inoculated groups after the onset of clinical signs following the first inoculation. A porcine mannan-binding lectin-A response was less evident in the pigs. Acute phase responses resembling those of the first inoculation were observed in the pigs that had not previously been inoculated and in the pigs treated with enrofloxacin. Acute phase responses were not recorded in the other three groups, where the pigs had seroconverted to A pleuropneumoniae serotype 2 following the first inoculation.
|
|
| 41. |
|
|
| 42. |
- Stenberg, Hedvig, et al.
(författare)
-
Congenital tremor and splay leg in piglets - insights into the virome, local cytokine response, and histology
- 2022
-
Ingår i: BMC Veterinary Research. - : Springer Science and Business Media LLC. - 1746-6148. ; 18
-
Tidskriftsartikel (refereegranskat)abstract
- Background: Atypical porcine pestivirus (APPV) is a neurotropic virus associated with congenital tremor type A-II. A few experimental studies also indicate an association between APPV and splay leg. The overarching aim of the present study was to provide insights into the virome, local cytokine response, and histology of the CNS in piglets with signs of congenital tremor or splay leg.Results: Characterization of the cytokine profile and virome of the brain in piglets with signs of congenital tremor revealed an APPV-associated upregulation of Stimulator of interferon genes (STING). The upregulation of STING was associated with an increased expression of the gene encoding IFN-alpha but no differential expression was recorded for the genes encoding CXCL8, IFN-beta, IFN-gamma, IL-1 beta, IL-6, or IL-10. No viral agents or cytokine upregulation could be detected in the spinal cord of piglets with signs of splay leg or in the brain of piglets without an APPV-infection. The histopathological examination showed no lesions in the CNS that could be attributed to the APPV-infection, as no difference between sick and healthy piglets could be seen.Conclusion: The results from this study provide evidence of an APPV-induced antiviral cytokine response but found no lesions related to the infection nor any support for a common causative agent.
|
|
| 43. |
|
|
| 44. |
|
|
| 45. |
- Timmusk, Sirje, et al.
(författare)
-
Regulator of G protein signalling 16 is target for a porcine circorvirus type 2 protein
- 2009
-
Ingår i: Journal of General Virology. - : Microbiology Society. - 0022-1317 .- 1465-2099. ; 90, s. 2425-2436
-
Tidskriftsartikel (refereegranskat)abstract
- Interaction studies have suggested that the non-structural protein encoded by open reading frame 3 (ORF3) of porcine circovirus type 2 (PCV2) binds specifically to a regulator of G protein signalling (RGS) related to human RGS16 (huRGS16). The full-length clone of RGS16 was generated from porcine cells and sequence analysis revealed a close relationship to huRGS16 and murine RGS16. In vitro pull-down experiments verified an interaction between porcine RGS16 (poRGS16) and ORF3 from PCV2. Using GST-linked ORF3 proteins from three different genogroups of PCV2 and from porcine circovirus type 1 (PCV1) in the pull-down experiments indicated that there were differences in their ability to bind poRGS16. Quantitative RT-PCR demonstrated that the expression of poRGS16 mRNA could be induced by a number of cell activators including mitogens (LPS and PHA), interferon inducers (ODN 2216 and poly I : C) and the neurotransmitter norepinephrine. Immunofluorescence labelling confirmed the induced expression of poRGS16 at the protein level and suggested that the PCV2 ORF3 protein co-localized with poRGS16 in LPS-activated porcine PBMC. Furthermore, poRGS16 appeared to participate in the translocation of the ORF3 protein into the cell nucleus, suggesting that the observed interaction may play an important role in the infection biology of porcine circovirus.
|
|
| 46. |
- Wallgren, Per, et al.
(författare)
-
The index herd with PMWS in Sweden: Presence of serum amyloid A, circovirus 2 viral load and antibody levels in healthy and PMWS-affected pigs
- 2009
-
Ingår i: Acta Veterinaria Scandinavica. - : Springer Science and Business Media LLC. - 0044-605X .- 1751-0147. ; 51, s. 1-11
-
Tidskriftsartikel (refereegranskat)abstract
- Conclusion: In this index case of PMWS in Sweden, pigs affected by PMWS were not able to mount a relevant serum antibody response which contributed to the disease progression. The maximal PCV2 virus load was significantly higher and was also detected at an earlier stage in PMWS-affected pigs than in healthy pigs. However, a viral load above 107 PCV2 DNA copies per ml serum was also recorded in 18 out of 34 pigs without any clinical signs of PMWS, suggesting that these pigs were able to initiate a protective immune response to PCV2.
|
|
| 47. |
- Wikström, Frida Hasslung, et al.
(författare)
-
Structure-dependent modulation of alpha interferon production by porcine circovirus 2 oligodeoxyribonucleotide and CpG DNAs in porcine peripheral blood mononuclear cells.
- 2007
-
Ingår i: Journal of virology. - : American Society for Microbiology. - 0022-538X .- 1098-5514. ; 81:10, s. 4919-27
-
Tidskriftsartikel (refereegranskat)abstract
- DNA sequences containing CpG motifs are recognized as immunomodulators in several species. Phosphodiester oligodeoxyribonucleotides (ODNs) representing sequences from the genome of porcine circovirus type 2 (PCV2) have been identified as potent inducers (ODN PCV2/5) or inhibitors (ODN PCV2/1) of alpha interferon (IFN-alpha) production by porcine peripheral blood mononuclear cells (poPBMCs) in vitro. In this study, the IFN-alpha-inducing or -inhibitory activities of specific phosphodiester ODNs were demonstrated to be dependent on their ability to form secondary structures. When a poly(G) sequence was added to a stimulatory self-complementary ODN, high levels of IFN-alpha were elicited, and the induction was not dependent on pretreatment with the transfecting agent Lipofectin. In addition, the IFN-alpha-inducing ODN required the presence of an intact CpG dinucleotide, whereas the inhibitory activity of ODN PCV2/1 was not affected by methylation or removal of the central CpG dinucleotide. Of particular significance, the IFN-alpha inhibition elicited by ODN PCV2/1 was only effective against induction stimulated by DNA control inducers and not RNA control inducers, indicating activity directed to TLR9 signaling. The PCV2 genome as a whole was demonstrated to induce IFN-alpha in cultures of poPBMCs, and the presence of immune modulatory sequences within the genome of PCV2 may, therefore, have implications with regard to the immune evasion mechanisms utilized by PCV2.
|
|
| 48. |
- Ye, Xingyu, et al.
(författare)
-
Detection and genetic characterisation of Porcine Circovirus 3 from pigs in Sweden
- 2018
-
Ingår i: Virus Genes. - : Springer Science and Business Media LLC. - 0920-8569 .- 1572-994X. ; 54, s. 466-469
-
Tidskriftsartikel (refereegranskat)abstract
- Porcine circovirus 3 (PCV3) is a newly detected circovirus belonging to the family Circoviridae with a circular ssDNA genome of 2000 bp that encodes two proteins-the replicase protein and the capsid protein. PCV3 was discovered for the first time in the US in 2016. After this initial discovery, PCV3 was detected in other parts of the world such as in China, South Korea, Italy and Poland. In this study, 49 tissue samples from Swedish pig herds were screened for PCV3 using PCR and 10 samples were positive and one was uncertain. The entire PCV3 genome and a mini PCV-like virus (MPCLV) were obtained from one of these samples. These two viruses showed a high sequence identity to PCV3 viruses from other countries as well as to MPCLV from the US. However, the sequence identity to PCV1 and 2 was only 31-48% on amino acid level. This is the first detection and complete genetic characterisation of PCV3 in Swedish pigs. It is also interesting to note that one of the positive samples was collected in 1993, showing that PCV3 has been present for a long time.
|
|
