SwePub - sökning: WFRF:(Magnusson Kristina)

Numrering	Referens	Omslagsbild	Hitta
1.	Kjällander, Susanne, et al. (författare) Förskolan behöver en digitaliseringsstrategi 2023 Ingår i: Svenska Dagbladet. - Stockholm. - 2001-3868. ; :18-jun Tidskriftsartikel (populärvet., debatt m.m.)
2.	Pramling, Ingrid, et al. (författare) 27 forskare i upprop mot skärmfri förskola 2024 Ingår i: Förskolan. - Stockholm : Sveriges Lärare. Tidskriftsartikel (populärvet., debatt m.m.)abstract VI LÄRARE DEBATT: Regeringens uppdrag till Skolverket – att göra utbildningen i förskolan skärmfri – riskerar att ge negativa och allvarliga konsekvenser, särskilt för barn som är i störst behov av att möta en digitaliserad värld med stöd av utbildade förskollärare och barnskötare. Det skriver 27 barn- och förskoleforskare i ett gemensamt upprop.
3.	Pramling Samuelsson, Ingrid, et al. (författare) 27 forskare i upprop mot skärmfri förskola 2024 Ingår i: Förskolan. - Stockholm : Sveriges Lärare. Tidskriftsartikel (populärvet., debatt m.m.)abstract VI LÄRARE DEBATT: Regeringens uppdrag till Skolverket – att göra utbildningen i förskolan skärmfri – riskerar att ge negativa och allvarliga konsekvenser, särskilt för barn som är i störst behov av att möta en digitaliserad värld med stöd av utbildade förskollärare och barnskötare. Det skriver 27 barn- och förskoleforskare i ett gemensamt upprop.
4.	Abarkan, Abdellah, et al. (författare) Corona hotar förvärra svenska bostadskrisen. 108 forskare: Sveriges regering och kommuner måste förhindra en katastrof. 2020 Ingår i: Aftonbladet. - 1103-9000. Tidskriftsartikel (populärvet., debatt m.m.)abstract Debattartikel och Öppet brev publicerad i tidningen Aftonbladet. 29.3. 2020.
5.	Abarkan, Abdellah, et al. (författare) Lyssna på forskningen : Den visar på avregleringens problem 2019 Ingår i: Dagens nyheter. - Stockholm : Dagens nyheter. - 1101-2447. ; :10/21/2019 Tidskriftsartikel (populärvet., debatt m.m.)
6.	Thelander, Gunilla, et al. (författare) Caffeine fatalities - Do sales restrictions prevent intentional intoxications? 2010 Ingår i: Clinical Toxicology. - : Informa Healthcare. - 1556-3650 .- 1556-9519. ; 48:4, s. 354-358 Tidskriftsartikel (refereegranskat)abstract Objective. Caffeine is widely available in beverages and in different over-the-counter products, including tablets containing 100 mg caffeine. Because intentional fatal intoxications with caffeine occur, the maximum quantity of caffeine tablets that can be bought over the counter in a single purchase was restricted from 250 to 30 in Sweden in the year 2004. The objective of this article was to study the effect of this decision on the number of fatal caffeine intoxications. Method. In Sweden 95% of all cases undergoing forensic autopsy are screened for a number of drugs including caffeine. All cases during January 1993-September 2009 with a caffeine concentration above 80 mu g/g blood were recorded. Results. During the study period toxicological investigations were performed in 83,580 forensic autopsies. Caffeine contributed to the fatal outcome in 20 cases (0.02%). Thirteen (65%) of these fatalities occurred before the introduction of the sales restriction. However, no fatal intoxications where caffeine contributed to the cause of death was recorded between May 2007 and September 2009. Conclusion. Overdoses of tablets containing caffeine can be fatal, suicides as well as accidents occur. Restricting the maximum quantity of caffeine tablets available over the counter seemed to be effective in preventing suicides because of caffeine although some time elapsed until the effect was noted. Further monitoring is required to ensure that the observed lower caffeine mortality is a sustained effect.
7.	Uhlén, Mathias, et al. (författare) A human protein atlas for normal and cancer tissues based on antibody proteomics 2005 Ingår i: Molecular & Cellular Proteomics. - 1535-9476 .- 1535-9484. ; 4:12, s. 1920-1932 Tidskriftsartikel (refereegranskat)abstract Antibody-based proteomics provides a powerful approach for the functional study of the human proteome involving the systematic generation of protein-specific affinity reagents. We used this strategy to construct a comprehensive, antibody-based protein atlas for expression and localization profiles in 48 normal human tissues and 20 different cancers. Here we report a new publicly available database containing, in the first version, similar to 400,000 high resolution images corresponding to more than 700 antibodies toward human proteins. Each image has been annotated by a certified pathologist to provide a knowledge base for functional studies and to allow queries about protein profiles in normal and disease tissues. Our results suggest it should be possible to extend this analysis to the majority of all human proteins thus providing a valuable tool for medical and biological research.
8.	Adliene, Diana, et al. (författare) Assessment of the environmental contamination with long-lived radionuclides around an operating RBMK reactor station 2006 Ingår i: Journal of Environmental Radioactivity. - : Elsevier BV. - 1879-1700 .- 0265-931X. ; 90:1, s. 68-77 Tidskriftsartikel (refereegranskat)abstract The presence of man-made gamma emitting radionuclides in the region within 32 km radius of the Ignalina NPP/Lithuania has been investigated during the period 2001-2004, prior to the closure of the first 4 the two operating RBMK 1500-type reactors. Gamma spectrometric measurements of various terrestrial and aquatic plants as well as of soil samples showed moderate environmental contamination with the fission product Cs-137 and with the neutron activation products Co-60 and Mn-54. Traces of the activation products Zn-65 and Ag-110m were found in the nearest vicinity of the NPP. Activity concentrations were inhomogeneously distributed in the area of interest. Moss and algae samples showed the highest uptake of radionuclides. In addition to the gamma spectrometric measurements, the levels of C-14 were determined in the same bio-indicator samples using accelerator mass spectrometry. (c) 2006 Elsevier Ltd. All rights reserved.
9.	Agnarsdóttir, Margrét, 1970-, et al. (författare) MITF as a Prognostic Marker in Cutaneous Malignant Melanoma Annan publikation (övrigt vetenskapligt/konstnärligt)abstract Background: Microphthalmia associated transcription factor (MITF) protein has a central role in the differentiation and survival of melanocytes. The aim of the study was to investigate whether MITF can be employed as a prognostic marker in patients operated on for cutaneous malignant melanoma. Methods: A cohort study design based on information collected from population-based registers. For included patients tissue microarrays and immunohistochemistry were employed to study the protein expression of MITF in the primary malignant melanoma tumors by estimating the fraction of positive tumor cells and the staining intensity. Results: The vast majority of tumors expressed MITF in >25% of the tumor cells with a strong staining intensity and looking at these factors individually these patients had a better prognosis. When cell fraction and intensity were combined a high-risk group dying of malignant melanoma was identified as those with 25% -75% of tumor cells staining with weak intensity and those with <25% of tumor cells staining with strong intensity. However, the majority of the deaths occurred in the lower risk groups. Conclusions: Although a high-risk group for death in malignant melanoma was identified we conclude that MITF is not useful as a prognostic marker because of the distribution of that particular expression in the population. Impact: Our results indicate a bi-phasic pattern of MITF expression and although not useful as a prognostic marker these results are in line with other experimental studies and are relevant to explore further.
10.	Agnarsdóttir, Margrét, 1970-, et al. (författare) Protein Biomarkers in Malignant Melanoma: An Image Analysis-Based Study on Melanoma Markers of Potential Clinical Relevance Annan publikation (övrigt vetenskapligt/konstnärligt)abstract The thickness of a primary malignant melanoma tumor is the most important prognostic indicator for a patient with primary cutaneous malignant melanoma. To optimize the management and treatment of melanoma patients there is an unmet need to identify characteristics that can further stratify melanoma patients into high or low risk for progressive disease. Despite numerous studies no single marker has yet been shown to add significant prognostic information. An algorithmic approach, combining data from several markers provides an attractive model to identify patients of increased risk of dying from malignant melanoma. The primary aim of the present study was to analyze the correlation between clinical outcome and protein expression patterns of multiple proteins in malignant melanoma tumors using immunohistochemistry and tissue microarrays. Candidate proteins were identified based on a selective and differential expression pattern in melanoma tumors and tested in a cohort of 143 melanoma patients. Protein expression was analyzed using both manual scoring and automated image analysis-based algorithms. We found no single marker of prognosis that was independent of tumor thickness. When combining potential prognostic markers we could define a prognostic index, based on RBM3, MITF, SOX10 and Ki-67, that was independent of tumor thickness in multivariate analysis. Our findings suggest that a good prognosis signature can be identified in melanoma patients with tumors showing a low fraction of Ki-67 positive tumor cells and a high fraction of RBM3 positive tumor cells combined with low intensity levels of SOX10 and MITF.
11.	Ahlén, Karina, et al. (författare) Platelet-derived growth factor-BB modulates membrane mobility of beta1 integrins. 2004 Ingår i: Biochem Biophys Res Commun. - 0006-291X. ; 314:1, s. 89-96 Tidskriftsartikel (refereegranskat)
12.	Allan, Julie, et al. (författare) Etiska perspektiv på specialpedagogers yrkesroll och värdepedagogiska praktik 2022 Bok (övrigt vetenskapligt/konstnärligt)abstract Yrkesetik handlar om att hantera motstridiga värden på ett professionellt sätt. Olika dilemman är ständigt närvarande i skolans vardag och kan handla om att minimera risken för att elever ska exkluderas eller om att säkerställa att elever får möjlighet att visa sina kunskaper på rätt sätt. I sin yrkesroll ställs specialpedagogen inför mångfacetterade arbetsuppgifter som omfattar att stödja barn och elever i svårigheter, vara en kvalificerad samtalspartner i pedagogiska frågor och samverka med andra yrkesgrupper för att utveckla skolans verksamhet. Arbetet innebär val mellan olika handlingsalternativ som kräver både kunskap och förmåga att urskilja och värdera etiska aspekter i komplexa sammanhang. I boken diskuteras både dilemman och möjligheter där etiska perspektiv spelar en viktig roll. Kapitlen tar upp frågor med praktiknära innehåll som lämpar sig för såväl individuell reflektion som kollegiala samtal med syftet att skapa ett gemensamt yrkesetiskt språk. Boken vänder sig till blivande och praktiserande specialpedagoger samt andra yrkeskategorier med arbetsuppgifter inom det specialpedagogiska området.
13.	Alvfors, Per, 1954-, et al. (författare) Research and development challenges for Swedish biofuel actors – three illustrative examples : Improvement potential discussed in the context of Well-to-Tank analyses 2010 Rapport (övrigt vetenskapligt/konstnärligt)abstract Currently biofuels have strong political support, both in the EU and Sweden. The EU has, for example, set a target for the use of renewable fuels in the transportation sector stating that all EU member states should use 10% renewable fuels for transport by 2020. Fulfilling this ambition will lead to an enormous market for biofuels during the coming decade. To avoid increasing production of biofuels based on agriculture crops that require considerable use of arable area, focus is now to move towards more advanced second generation (2G) biofuels that can be produced from biomass feedstocks associated with a more efficient land use. Climate benefits and greenhouse gas (GHG) balances are aspects often discussed in conjunction with sustainability and biofuels. The total GHG emissions associated with production and usage of biofuels depend on the entire fuel production chain, mainly the agriculture or forestry feedstock systems and the manufacturing process. To compare different biofuel production pathways it is essential to conduct an environmental assessment using the well-to-tank (WTT) analysis methodology. In Sweden the conditions for biomass production are favourable and we have promising second generation biofuels technologies that are currently in the demonstration phase. In this study we have chosen to focus on cellulose based ethanol, methane from gasification of solid wood as well as DME from gasification of black liquor, with the purpose of identifying research and development potentials that may result in improvements in the WTT emission values. The main objective of this study is thus to identify research and development challenges for Swedish biofuel actors based on literature studies as well as discussions with the the researchers themselves. We have also discussed improvement potentials for the agriculture and forestry part of the WTT chain. The aim of this study is to, in the context of WTT analyses, (i) increase knowledge about the complexity of biofuel production, (ii) identify and discuss improvement potentials, regarding energy efficiency and GHG emissions, for three biofuel production cases, as well as (iii) identify and discuss improvement potentials regarding biomass supply, including agriculture/forestry. The scope of the study is limited to discussing the technologies, system aspects and climate impacts associated with the production stage. Aspects such as the influence on biodiversity and other environmental and social parameters fall beyond the scope of this study. We find that improvement potentials for emissions reductions within the agriculture/forestry part of the WTT chain include changing the use of diesel to low-CO2-emitting fuels, changing to more fuel-efficient tractors, more efficient cultivation and manufacture of fertilizers (commercial nitrogen fertilizer can be produced in plants which have nitrous oxide gas cleaning) as well as improved fertilization strategies (more precise nitrogen application during the cropping season). Furthermore, the cultivation of annual feedstock crops could be avoided on land rich in carbon, such as peat soils and new agriculture systems could be introduced that lower the demand for ploughing and harrowing. Other options for improving the WTT emission values includes introducing new types of crops, such as wheat with higher content of starch or willow with a higher content of cellulose. From the case study on lignocellulosic ethanol we find that 2G ethanol, with co-production of biogas, electricity, heat and/or wood pellet, has a promising role to play in the development of sustainable biofuel production systems. Depending on available raw materials, heat sinks, demand for biogas as vehicle fuel and existing 1G ethanol plants suitable for integration, 2G ethanol production systems may be designed differently to optimize the economic conditions and maximize profitability. However, the complexity connected to the development of the most optimal production systems require improved knowledge and involvement of several actors from different competence areas, such as chemical and biochemical engineering, process design and integration and energy and environmental systems analysis, which may be a potential barrier.
14.	Alvfors, Per, et al. (författare) Research and development challenges for Swedish biofuel actors – three illustrative examples 2010 Rapport (övrigt vetenskapligt/konstnärligt)abstract Currently biofuels have strong political support, both in the EU and Sweden. The EU has, for example, set a target for the use of renewable fuels in the transportation sector stating that all EU member states should use 10% renewable fuels for transport by 2020. Fulfilling this ambition will lead to an enormous market for biofuels during the coming decade. To avoid increasing production of biofuels based on agriculture crops that require considerable use of arable area, focus is now to move towards more advanced second generation (2G) biofuels that can be produced from biomass feedstocks associated with a more efficient land use.Climate benefits and greenhouse gas (GHG) balances are aspects often discussed in conjunction with sustainability and biofuels. The total GHG emissions associated with production and usage of biofuels depend on the entire fuel production chain, mainly the agriculture or forestry feedstock systems and the manufacturing process. To compare different biofuel production pathways it is essential to conduct an environmental assessment using the well-to-tank (WTT) analysis methodology. In Sweden the conditions for biomass production are favourable and we have promising second generation biofuels technologies that are currently in the demonstration phase. In this study we have chosen to focus on cellulose based ethanol, methane from gasification of solid wood as well as DME from gasification of black liquor, with the purpose of identifying research and development potentials that may result in improvements in the WTT emission values. The main objective of this study is thus to identify research and development challenges for Swedish biofuel actors based on literature studies as well as discussions with the the researchers themselves. We have also discussed improvement potentials for the agriculture and forestry part of the WTT chain. The aim of this study is to, in the context of WTT analyses, (i) increase knowledge about the complexity of biofuel production, (ii) identify and discuss improvement potentials, regarding energy efficiency and GHG emissions, for three biofuel production cases, as well as (iii) identify and discuss improvement potentials regarding biomass supply, including agriculture/forestry. The scope of the study is limited to discussing the technologies, system aspects and climate impacts associated with the production stage. Aspects such as the influence on biodiversity and other environmental and social parameters fall beyond the scope of this study. We find that improvement potentials for emissions reductions within the agriculture/forestry part of the WTT chain include changing the use of diesel to low-CO2-emitting fuels, changing to more fuel-efficient tractors, more efficient cultivation and manufacture of fertilizers (commercial nitrogen fertilizer can be produced in plants which have nitrous oxide gas cleaning) as well as improved fertilization strategies (more precise nitrogen application during the cropping season). Furthermore, the cultivation of annual feedstock crops could be avoided on land rich in carbon, such as peat soils and new agriculture systems could be introduced that lower the demand for ploughing and harrowing. Other options for improving the WTT emission values includes introducing new types of crops, such as wheat with higher content of starch or willow with a higher content of cellulose. From the case study on lignocellulosic ethanol we find that 2G ethanol, with co-production of biogas, electricity, heat and/or wood pellet, has a promising role to play in the development of sustainable biofuel production systems. Depending on available raw materials, heat sinks, demand for biogas as vehicle fuel and existing 1G ethanol plants suitable for integration, 2G ethanol production systems may be designed differently to optimize the economic conditions and maximize profitability. However, the complexity connected to the development of the most optimal production systems require improved knowledge and involvement of several actors from different competence areas, such as chemical and biochemical engineering, process design and integration and energy and environmental systems analysis, which may be a potential barrier. Three important results from the lignocellulosic ethanol study are: (i) the production systems could be far more complex and intelligently designed than previous studies show, (ii) the potential improvements consist of a large number of combinations of process integration options wich partly depends on specific local conditions, (iii) the environmental performance of individual systems may vary significantly due to systems design and local conditons.From the case study on gasification of solid biomass for the production of biomethane we find that one of the main advantages of this technology is its high efficiency in respect to converting biomass into fuels for transport. For future research we see a need for improvements within the gas up-grading section, including gas cleaning and gas conditioning, to obtain a more efficient process. A major challenge is to remove the tar before the methanation reaction. Three important results from the biomethane study are: (i) it is important not to crack the methane already produced in the syngas, which indicates a need for improved catalysts for selective tar cracking, (ii) there is a need for new gas separation techniques to facilitate the use of air oxidation agent instead of oxygen in the gasifier, and (iii) there is a need for testing the integrated process under realistic conditions, both at atmospheric and pressurized conditions. From the case study on black liquor gasification for the production of DME we find that the process has many advantages compared to other biofuel production options, such as the fact that black liquor is already partially processed and exists in a pumpable, liquid form, and that the process is pressurised and tightly integrated with the pulp mill, which enhances fuel production efficiency. However, to achieve commercial status, some challenges still remain, such as demonstrating that materials and plant equipment meet the high availability required when scaling up to industrial size in the pulp mill, and also proving that the plant can operate according to calculated heat and material balances. Three important results from the DME study are: (i) that modern chemical pulp mills, having a potential surplus of energy, could become important suppliers of renewable fuels for transport, (ii) there is a need to demonstrate that renewable DME/methanol will be proven to function in large scale, and (iii) there is still potential for technology improvements and enhanced energy integration. Although quantitative improvement potentials are given in the three biofuel production cases, it is not obvious how these potentials would affect WTT values, since the biofuel production processes are complex and changing one parameter impacts other parameters. The improvement potentials are therefore discussed qualitatively. From the entire study we have come to agree on the following common conclusions: (i) research and development in Sweden within the three studied 2G biofuel production technologies is extensive, (ii) in general, the processes, within the three cases, work well at pilot and demonstration scale and are now in a phase to be proven in large scale, (iii) there is still room for improvement although some processes have been known for decades, (iv) the biofuel production processes are complex and site specific and process improvements need to be seen and judged from a broad systems perspective (both within the production plant as well as in the entire well-to-tank perspective), and (v) the three studied biofuel production systems are complementary technologies. Futher, the process of conducting this study is worth mentioning as a result itself, i.e. that many different actors within the field have proven their ability and willingness to contribute to a common report, and that the cooperation climate was very positive and bodes well for possible future collaboration within the framework of the f3 center. Finally, judging from the political ambitions it is clear that the demand for renewable fuels will significantly increase during the coming decade. This will most likely result in opportunities for a range of biofuel options. The studied biofuel options all represent 2G biofuels and they can all be part of the solution to meet the increased renewable fuel demand.
15.	Alvors, Per, et al. (författare) Research and development challenges for Swedish biofuel actors – three illustrative examples : Improvement potential discussed in the context of Well-to-Tank analyses 2010 Rapport (övrigt vetenskapligt/konstnärligt)abstract Currently biofuels have strong political support, both in the EU and Sweden. The EU has, for example, set a target for the use of renewable fuels in the transportation sector stating that all EU member states should use 10% renewable fuels for transport by 2020. Fulfilling this ambition will lead to an enormous market for biofuels during the coming decade. To avoid increasing production of biofuels based on agriculture crops that require considerable use of arable area, focus is now to move towards more advanced second generation (2G) biofuels that can be produced from biomass feedstocks associated with a more efficient land use.Climate benefits and greenhouse gas (GHG) balances are aspects often discussed in conjunction with sustainability and biofuels. The total GHG emissions associated with production and usage of biofuels depend on the entire fuel production chain, mainly the agriculture or forestry feedstock systems and the manufacturing process. To compare different biofuel production pathways it is essential to conduct an environmental assessment using the well-to-tank (WTT) analysis methodology.In Sweden the conditions for biomass production are favourable and we have promising second generation biofuels technologies that are currently in the demonstration phase. In this study we have chosen to focus on cellulose based ethanol, methane from gasification of solid wood as well as DME from gasification of black liquor, with the purpose of identifying research and development potentials that may result in improvements in the WTT emission values. The main objective of this study is thus to identify research and development challenges for Swedish biofuel actors based on literature studies as well as discussions with the the researchers themselves. We have also discussed improvement potentials for the agriculture and forestry part of the WTT chain. The aim of this study is to, in the context of WTT analyses, (i) increase knowledge about the complexity of biofuel production, (ii) identify and discuss improvement potentials, regarding energy efficiency and GHG emissions, for three biofuel production cases, as well as (iii) identify and discuss improvement potentials regarding biomass supply, including agriculture/forestry. The scope of the study is limited to discussing the technologies, system aspects and climate impacts associated with the production stage. Aspects such as the influence on biodiversity and other environmental and social parameters fall beyond the scope of this study.We find that improvement potentials for emissions reductions within the agriculture/forestry part of the WTT chain include changing the use of diesel to low-CO2-emitting fuels, changing to more fuel-efficient tractors, more efficient cultivation and manufacture of fertilizers (commercial nitrogen fertilizer can be produced in plants which have nitrous oxide gas cleaning) as well as improved fertilization strategies (more precise nitrogen application during the cropping season). Furthermore, the cultivation of annual feedstock crops could be avoided on land rich in carbon, such as peat soils and new agriculture systems could be introduced that lower the demand for ploughing and harrowing. Other options for improving the WTT emission values includes introducing new types of crops, such as wheat with higher content of starch or willow with a higher content of cellulose.From the case study on lignocellulosic ethanol we find that 2G ethanol, with co-production of biogas, electricity, heat and/or wood pellet, has a promising role to play in the development of sustainable biofuel production systems. Depending on available raw materials, heat sinks, demand for biogas as vehicle fuel and existing 1G ethanol plants suitable for integration, 2G ethanol production systems may be designed differently to optimize the economic conditions and maximize profitability. However, the complexity connected to the development of the most optimal production systems require improved knowledge and involvement of several actors from different competence areas, such as chemical and biochemical engineering, process design and integration and energy and environmental systems analysis, which may be a potential barrier.Three important results from the lignocellulosic ethanol study are: (i) the production systems could be far more complex and intelligently designed than previous studies show, (ii) the potential improvements consist of a large number of combinations of process integration options wich partly depends on specific local conditions, (iii) the environmental performance of individual systems may vary significantly due to systems design and local conditons.From the case study on gasification of solid biomass for the production of biomethane we find that one of the main advantages of this technology is its high efficiency in respect to converting biomass into fuels for transport. For future research we see a need for improvements within the gas up-grading section, including gas cleaning and gas conditioning, to obtain a more efficient process. A major challenge is to remove the tar before the methanation reaction.Three important results from the biomethane study are: (i) it is important not to crack the methane already produced in the syngas, which indicates a need for improved catalysts for selective tar cracking, (ii) there is a need for new gas separation techniques to facilitate the use of air oxidation agent instead of oxygen in the gasifier, and (iii) there is a need for testing the integrated process under realistic conditions, both at atmospheric and pressurized conditions.From the case study on black liquor gasification for the production of DME we find that the process has many advantages compared to other biofuel production options, such as the fact that black liquor is already partially processed and exists in a pumpable, liquid form, and that the process is pressurised and tightly integrated with the pulp mill, which enhances fuel production efficiency. However, to achieve commercial status, some challenges still remain, such as demonstrating that materials and plant equipment meet the high availability required when scaling up to industrial size in the pulp mill, and also proving that the plant can operate according to calculated heat and material balances. Three important results from the DME study are: (i) that modern chemical pulp mills, having a potential surplus of energy, could become important suppliers of renewable fuels for transport, (ii) there is a need to demonstrate that renewable DME/methanol will be proven to function in large scale, and (iii) there is still potential for technology improvements and enhanced energy integration.Although quantitative improvement potentials are given in the three biofuel production cases, it is not obvious how these potentials would affect WTT values, since the biofuel production processes are complex and changing one parameter impacts other parameters. The improvement potentials are therefore discussed qualitatively. From the entire study we have come to agree on the following common conclusions: (i) research and development in Sweden within the three studied 2G biofuel production technologies is extensive, (ii) in general, the processes, within the three cases, work well at pilot and demonstration scale and are now in a phase to be proven in large scale, (iii) there is still room for improvement although some processes have been known for decades, (iv) the biofuel production processes are complex and site specific and process improvements need to be seen and judged from a broad systems perspective (both within the production plant as well as in the entire well-to-tank perspective), and (v) the three studied biofuel production systems are complementary technologies. Futher, the process of conducting this study is worth mentioning as a result itself, i.e. that many different actors within the field have proven their ability and willingness to contribute to a common report, and that the cooperation climate was very positive and bodes well for possible future collaboration within the framework of the f3 center.Finally, judging from the political ambitions it is clear that the demand for renewable fuels will significantly increase during the coming decade. This will most likely result in opportunities for a range of biofuel options. The studied biofuel options all represent 2G biofuels and they can all be part of the solution to meet the increased renewable fuel demand.
16.	Atterby, Clara, et al. (författare) Carriage of carbapenemase- and extended-spectrum cephalosporinase-producing Escherichia coli and Klebsiella pneumoniae in humans and livestock in rural Cambodia; gender and age differences and detection of blaOXA-48 in humans. 2019 Ingår i: Zoonoses and Public Health. - : Wiley-VCH Verlagsgesellschaft. - 1863-1959 .- 1863-2378. ; 66:6, s. 603-617 Tidskriftsartikel (refereegranskat)abstract OBJECTIVES: This study investigates the frequency and characteristics of carbapenemase-producing Escherichia coli/Klebsiella pneumoniae (CPE/K) and extended-spectrum cephalosporinase-producing E. coli/K. pneumoniae (ESCE/K) in healthy humans and livestock in rural Cambodia. Additionally, household practices as risk factors for faecal carriage of ESCE/K are identified.METHODS: Faecal samples were obtained from 307 humans and 285 livestock including large ruminants, pigs and poultry living in 100 households in rural Cambodia in 2011. Each household was interviewed, and multilevel logistic model determined associations between household practices/meat consumption and faecal carriage of ESCE/K. CPE and ESCE/K were detected and further screened for colistin resistance genes.RESULTS: CPE/K isolates harbouring blaOXA-48 were identified in two humans. The community carriage of ESCE/K was 20% in humans and 23% in livestock. The same ESBL genes: blaCTX-M-15 , blaCTX-M-14 , blaCTX-M-27 , blaCTX-M-55 , blaSHV-2 , blaSHV-12 , blaSHV-28 ; AmpC genes: blaCMY-2 , blaCMY-42, blaDHA-1 ; and colistin resistance genes: mcr-1-like and mcr-3-like were detected in humans and livestock. ESCE/K was frequently detected in women, young children, pigs and poultry, which are groups in close contact. The practice of burning or burying meat waste and not collecting animal manure indoors and outdoors daily were identified as risk factors for faecal carriage of ESCE/K.CONCLUSIONS: Faecal carriage of E. coli and K. pneumoniae harbouring extended-spectrum cephalosporinase genes are common in the Cambodian community, especially in women and young children. Exposure to animal manure and slaughter products are risk factors for intestinal colonization of ESCE/K in humans.
17.	Babiker, Adil A., et al. (författare) Mapping pro- and antiangiogenic factors on the surface of prostasomes of normal and malignant cell origin 2010 Ingår i: The Prostate. - : Wiley. - 0270-4137 .- 1097-0045. ; 70:8, s. 834-847 Tidskriftsartikel (refereegranskat)abstract BACKGROUND: Angiogenesis is the formation of new blood vessels by capillary sprouting from pre-existing vessels. Tumor growth is angiogenesis-dependent and the formation of new blood vessels is associated with the increased expression of angiogenic factors. Prostasomes are secretory granules produced, stored and released by the glandular epithelial cells of the prostate. We investigated the expression of selected angiogenic and anti-angiogenic factors on the surface of prostasomes of different origins as well as the direct effect of prostasomes on angiogenesis. METHODS: VEGF, endothelin-1, endostatin, and thrombospondin-1 were determined on prostasomes from seminal fluid and human prostate cancer cell lines (DU145,PC-3,LNCaP) using different immunochemical techniques. Human dermal microvascular endothelial cells were incubated with seminal and DU145 cell-prostasomes and with radioactive thymidine. The effect of prostasomes on angiogenesis was judged by measuring the uptake of labeled thymidine. The presence of any deleterious effects of prostasomes on the endothelial cells was investigated using thymidine assay and confocal laser microscopy. RESULTS: VEGF and endothelin-1 were determined on malignant cell-prostasomes (no difference between cell lines) but not determined on seminal prostasomes. The same applies for the expression of endostatin but with much higher expression on malignant cell-prostasomes with obvious differences between them. Seminal and DU145 cell-prostasomes were found to have anti-angiogenic effect which was more expressed by DU145 cell-prostasomes. No deleterious effect of prostasomes on endothelial function was detected using either thymidine assay or microscopy. CONCLUSIONS: Prostasomes contain pro- and anti-angiogenic factors that function to counteract each other unless the impact from one side exceeds the other to bring about dysequilibrium.
18.	Björksved, Margitha, 1964-, et al. (författare) CLOSED VERSUS OPEN SURGICAL EXPOSURE OF PALATALLY DISPLACED CANINES : ERUPTION TIME, COMPLICATIONS AND PATIENT PERCEPTIONS; A RANDOMIZED CONTROLLED TRIAL 2018 Konferensbidrag (refereegranskat)
19.	Björksved, Margitha, 1964-, et al. (författare) Closed vs open surgical exposure of palatally displaced canines : surgery time, postoperative complications, and patients' perceptions 2018 Ingår i: European Journal of Orthodontics. - : Oxford University Press. - 0141-5387 .- 1460-2210. ; 40:6, s. 626-635 Tidskriftsartikel (refereegranskat)abstract Background: Closed and open surgical techniques are two different main approaches to surgical exposure of palatally displaced canines (PDCs). Because there is insufficient evidence to support one technique over the other, there is a need for randomized controlled trials.Objectives: To compare surgery time, complications and patients' perceptions between closed and open surgical techniques in PDCs.Trial design: The trial was a multicentre, randomized, controlled trial with two parallel groups randomly allocated in a 1:1 ratio.Material and methods: Study participants were 119 consecutive patients from 3 orthodontic centres, with PDCs planned for surgical exposure, randomly allocated according to a computer-generated randomization list, using concealed allocation. Full-thickness mucoperiosteal flap was raised, and bone covering the canine was removed in both interventions. In closed exposure, an attachment with a chain was bonded to the canine and the flap was sutured back with the chain penetrating the mucosa. In open exposure, a window of tissue around the tooth was removed and glass ionomer cement placed on the canine crown, to prevent gingival overgrowth during spontaneous eruption. Patient perceptions were assessed with two questionnaires, for the evening on the day of operation and 7 days post-surgery.Blinding: It was not possible to blind either patients or care providers to the interventions. The outcome assessors were blinded and were unaware of patients' intervention group.Results: Seventy-five girls and 44 boys, mean age 13.4 years (SD 1.46) participated in the study and got either of the interventions (closed exposure, n = 60; open exposure, n = 59). Surgery time did not differ significantly between the interventions. Complications though were more severe in bilateral cases and the patients experienced more pain and impairment in the open group.Conclusion: There were no statistically significant differences regarding surgery time between the groups. Postoperative complications were similar between the groups in unilateral PDCs, but more common in the open group in bilateral cases. More patients in the open group experienced pain and impairment compared to the closed group.Trial registration: Trial registration: ClinicalTrials.gov, ID: NCT02186548 and Researchweb.org, ID: 127201.
20.	Björksved, Margitha, 1964-, et al. (författare) JÄMFÖRELSE AV SLUTEN OCH ÖPPEN KIRURGISK FRILÄGGNING AV PALATINALT FELSTÄLLDA HÖRNTÄNDER : OPERATIONSTID, KOMPLIKATIONER OCH PATIENTERFARENHETER. EN MULTICENTER PROSPEKTIV RANDOMISERAD KONTROLLERAD STUDIE 2019 Konferensbidrag (refereegranskat)
21.	Björksved, Margitha, 1964-, et al. (författare) Open vs closed surgical exposure of palatally displaced canines: a comparison of clinical and patient-reported outcomes-a multicentre, randomized controlled trial 2021 Ingår i: European Journal of Orthodontics. - : Oxford University Press (OUP). - 0141-5387 .- 1460-2210. ; 43:5, s. 487-497 Tidskriftsartikel (refereegranskat)abstract Objectives: To compare treatment time, patients' perceptions during orthodontic treatment, dental fear and side effects, between open and closed surgical exposures in patients with palatally displaced canines (PDCs). Trial design: Multicentre, randomized controlled trial, with random 1:1 allocation of two parallel groups. Materials and methods: One hundred and twenty patients from three different orthodontic centres were randomized into one of the two intervention arms, open or closed surgical exposure. Both techniques had mucoperiosteal flaps raised and bone removed above the PDCs. In open exposure, tissue was removed above the canine, and glass ionomer - reaching above soft tissue - was built on the crown. The canine was then left to erupt spontaneously, prior to orthodontic alignment. At closed exposure, a chain was bonded to the canine and orthodontic traction was applied under the mucosa until eruption. Orthodontic alignment of the canines was undertaken after eruption into the oral cavity, with fixed appliances in both groups. All participants were treated according to intention to treat (ITT). Blinding: Due to the nature of this trial, only outcome assessors could be blinded to the intervention group. Results: One hundred and seventeen patients completed the trial. All PDCs were successfully aligned. Total treatment time was equal in the two techniques, mean difference -0.1 months (95% CI -3.2 to 2.9, P = 0.93). The closed group experienced more pain and discomfort during the active orthodontic traction. Dental fear, root resorption and periodontal status did not show any clinically significant differences between the groups. Generalizability: Results of this randomized controlled trial (RCT) can be generalized only to a similar population aged 9-16 years, if exclusion criteria are met. Conclusion: The closed exposure group experienced more pain and discomfort mostly during active orthodontic traction. All other studied outcomes were similar between the two exposure groups.
22.	Blindow, Katrina Julia, et al. (författare) Sexual and gender harassment and use of psychotropic medication among Swedish workers : a prospective cohort study 2022 Ingår i: Occupational and Environmental Medicine. - : BMJ. - 1351-0711 .- 1470-7926. ; 79:8, s. 507-513 Tidskriftsartikel (refereegranskat)abstract OBJECTIVE: To estimate the prospective association between the exposure to three types of gender-based violence and harassment (GBVH) and psychotropic medication.METHODS: Information on three measures of workplace GBVH-sexual harassment (1) from superiors or colleagues, (2) from others (eg, clients) and (3) gender harassment from superiors or colleagues-were retrieved from the biannual Swedish Work Environment Survey 2007-2013 (N=23 449), a representative sample of working 16-64 years old registered in Sweden. The survey answers were merged with data on antidepressants, hypnotics/sedatives and anxiolytics from the Swedish Prescribed Drug Register. Cox proportional hazards analyses with days to purchase as time scale and first instance of medicine purchase as failure event were fitted, adjusted for demographic and workplace factors.RESULTS: Workers who reported exposure to gender harassment only (HR 1.2, 95% CI 1.07 to 1.36), to sexual but not gender harassment (HR 1.21, 95% CI 1.04 to 1.40), or to gender and sexual harassment (HR 1.31, 95% CI 1.08 to 1.60) had an excess risk of psychotropics use in comparison to workers who reported neither of the exposures in the past 12 months. We found no interaction between the exposures and gender in the association with psychotropics use.CONCLUSIONS: Exposure to sexual or gender harassment at the workplace may contribute to the development of mental disorders.
23.	Blomqvist, Sandra, et al. (författare) Downsizing and purchases of psychotropic drugs : a longitudinal study of stayers, changers and unemployed Annan publikation (övrigt vetenskapligt/konstnärligt)
24.	Blomqvist, Sandra, et al. (författare) Labor market exit around retirement age in Sweden and trajectories of psychotropic drugs in a context of downsizing 2020 Ingår i: BMC Public Health. - : Springer Science and Business Media LLC. - 1471-2458. ; 20:1 Tidskriftsartikel (refereegranskat)abstract Background A maintained psychological wellbeing is important in order to continue working longer and remain active into older age. However, little is known about impact of different organizational factors, such as downsizing, on the mental health of older workers exiting the labor market. The aim in this study was to investigate trajectories of purchases of psychotropic drugs in relation to labor market exit later in life in a context with and without downsizing. Method People living in Sweden, born 1941-1951, exiting paid work via unemployment, sickness absence/disability pension, or old-age pension were followed from 2005 to 2013 regarding purchases of psychotropic drugs. Individuals employed at a workplace closing down or downsizing with >= 18% between two subsequent years were compared to employees exiting from workplaces without downsizing or workplace closure. Generalized estimating equations was applied to derive trajectories of annual prevalence of purchased antidepressants, sedatives and anxiolytics from 4 years before to 4 years after a labour market exit. Results During the period around the exit, old-age retirees experiencing a downsizing/workplace closure did not decrease their purchases of sedatives (OR 1.01 95% CI 0.95-1.07) while the unexposed decreased their purchases during this period (OR 0.95 95% CI 0.92-0.98). Similar differences concerning sedatives and antidepressants between exposed and unexposed were seen for those exiting via sickness absence or disability pension. Furthermore, a significant difference in purchases of anxiolytics was observed between those exposed to downsizing (OR 1.10 95% CI 0.97-1.24) and the unexposed (OR 0.98 95% CI 0.91-1.06) exiting via old-age retirement during the time before the exit. Conclusion Downsizing or workplace closure, although weakly, was associated with higher prevalence of psychotropic drugs certain years around the labor market exit. The results support the idea that involuntary labor market exit in mature adulthood may negatively affect the development of mental health.
25.	Cepeda, D., et al. (författare) CDK-mediated activation of the SCFFBXO28 ubiquitin ligase promotes MYC-driven transcription and tumourigenesis and predicts poor survival in breast cancer 2013 Ingår i: EMBO Molecular Medicine. - : EMBO. - 1757-4676 .- 1757-4684. ; 5:7, s. 999-1018 Tidskriftsartikel (refereegranskat)abstract SCF (Skp1/Cul1/F-box) ubiquitin ligases act as master regulators of cellular homeostasis by targeting key proteins for ubiquitylation. Here, we identified a hitherto uncharacterized F-box protein, FBXO28 that controls MYC-dependent transcription by non-proteolytic ubiquitylation. SCFFBXO28 activity and stability are regulated during the cell cycle by CDK1/2-mediated phosphorylation of FBXO28, which is required for its efficient ubiquitylation of MYC and downsteam enhancement of the MYC pathway. Depletion of FBXO28 or overexpression of an F-box mutant unable to support MYC ubiquitylation results in an impairment of MYC-driven transcription, transformation and tumourigenesis. Finally, in human breast cancer, high FBXO28 expression and phosphorylation are strong and independent predictors of poor outcome. In conclusion, our data suggest that SCFFBXO28 plays an important role in transmitting CDK activity to MYC function during the cell cycle, emphasizing the CDK-FBXO28-MYC axis as a potential molecular drug target in MYC-driven cancers, including breast cancer. FBXO28 is identified as part of a SCF complex acting as a regulator of tumor cell proliferation and an important modifier of MYC function. FBXO28 may be a new prognostic factor in breast cancer and a new potential drug target in MYC- driven tumors.
26.	Cross, Michael J, et al. (författare) The Shb Adaptor Protein Binds to Tyrosine 766 in the FGFR-1 and Regulatesthe Ras/MEK/MAPK Pathway via FRS2 Phosphorylation in Endothelial Cells 2002 Ingår i: Molecular Biology of the Cell. - 1059-1524 .- 1939-4586. ; 13:8, s. 2881-2893 Tidskriftsartikel (refereegranskat)abstract Stimulation of fibroblast growth factor receptor-1 (FGFR-1) is known to result in phosphorylation of tyrosine 766 and the recruitment and subsequent activation of phospholipase C-γ (PLC-γ). To assess the role of tyrosine 766 in endothelial cell function, we generated endothelial cells expressing a chimeric receptor, composed of the extracellular domain of the PDGF receptor-α and the intracellular domain of FGFR-1. Mutation of tyrosine 766 to phenylalanine prevented PLC-γ activation and resulted in a reduced phosphorylation of FRS2 and reduced activation of the Ras/MEK/MAPK pathway relative to the wild-type chimeric receptor. However, FGFR-1–mediated MAPK activation was not dependent on PKC activation or intracellular calcium, both downstream mediators of PLC-γ activation. We report that the adaptor protein Shb is also able to bind tyrosine 766 in the FGFR-1, via its SH2 domain, resulting in its subsequent phosphorylation. Overexpression of an SH2 domain mutant Shb caused a dramatic reduction in FGFR-1–mediated FRS2 phosphorylation with concomitant perturbment of the Ras/MEK/MAPK pathway. Expression of the chimeric receptor mutant and the Shb SH2 domain mutant resulted in a similar reduction in FGFR-1–mediated mitogenicity. We conclude, that Shb binds to tyrosine 766 in the FGFR-1 and regulates FGF-mediated mitogenicity via FRS2 phosphorylation and the subsequent activation of the Ras/MEK/MAPK pathway.
27.	Dahlman, Disa, et al. (författare) Cervical cancer among Swedish women with drug use disorders : A nationwide epidemiological study 2021 Ingår i: Gynecologic Oncology. - : Elsevier BV. - 0090-8258. ; 160:3, s. 742-747 Tidskriftsartikel (refereegranskat)abstract Background/Aim: Cervical cancer incidence and mortality has decreased after introduction of national screening in Sweden, but women with drug use disorders (DUD) are less likely to participate in screening programs. We aimed to investigate cervical cancer incidence and mortality among women with DUD compared to the general female population in Sweden. Methods: We conducted a cohort study based on Swedish national register data for the period January 1997–December 2015. Data was collected for 3,838,248 women aged 15–75 years of whom 50,858 had DUD. Adjusted hazard ratios (HRs) for incident and fatal cervical cancer were calculated for women with and without DUD using Cox regression analysis. Results: DUD was significantly associated with incident cervical cancer (HR = 1.39, 95% confidence interval [CI] 1.39–1.61), but not fatal cervical cancer (HR = 1.25, 95% CI: 0.91–1.71), after adjusting for age, educational attainment, social welfare, region of residence, marital status and HIV infection. Conclusion: Women with DUD were thus identified as a risk group for incident cervical cancer, which calls for attention from clinicians and policy makers. It is possible that non-attendance in cancer screening and other healthcare seeking barriers may affect the risk of incident cervical cancer among women with DUD but more research on this topic is needed.
28.	Dahlman, Disa, et al. (författare) Drug use disorder and risk of incident and fatal breast cancer : a nationwide epidemiological study 2021 Ingår i: Breast Cancer Research and Treatment. - : Springer Science and Business Media LLC. - 0167-6806 .- 1573-7217. ; 186:1, s. 199-207 Tidskriftsartikel (refereegranskat)abstract Purpose: Breast cancer is one of the most common cancer forms in women and it is often detected by screening. However, women with drug use disorders (DUD) are less likely to be reached by screening programs. In this study, we aimed to investigate breast cancer incidence, mortality and stage at time of diagnosis among women with DUD compared to the general female population in Sweden. Methods: We performed a follow-up study based on Swedish national register data for the period January 1997–December 2015. The study was based on 3,838,248 women aged 15–75 years, of whom 50,858 were registered with DUD. Adjusted hazard ratios (HRs) for incident and fatal breast cancer, and cancer stage at time of diagnosis, were calculated for women with and without DUD using Cox regression analysis. Results: DUD was associated with incident breast cancer (HR 1.08, 95% confidence interval [CI] 1.02–1.14, p = 0.0069), fatal breast cancer (HR 1.60, 95% CI 1.42–1.82, p < 0.001), and stage IV breast cancer, i.e. metastasis at diagnosis (HR 2.06, 95% CI 1.44–2.95, p < 0.001). Conclusions: Women with DUD were identified as a risk group for incident, fatal and metastasized breast cancer, which calls for attention from clinicians and policy makers. Cancer screening attendance and other healthcare seeking barriers are likely to affect the risk increase among women who use drugs; however, more research is needed on the underlying mechanisms.
29.	de Bruijn, Winnie, et al. (författare) Introduction and Utilization of High Priced HCV Medicines across Europe : Implications for the Future 2016 Ingår i: Frontiers in Pharmacology. - : Frontiers Media SA. - 1663-9812. ; 7 Tidskriftsartikel (refereegranskat)abstract Background: Infection with the Hepatitis C Virus (HCV) is a widespread transmittable disease with a diagnosed prevalence of 2.0%. Fortunately, it is now curable in most patients. Sales of medicines to treat HCV infection grew 2.7% per year between 2004 and 2011, enhanced by the launch of the protease inhibitors (Hs) boceprevir (BCV) and telaprevir (TVR) in addition to ribavirin and pegylated interferon (pegIFN). Costs will continue to rise with new treatments including sofosbuvir, which now include interferon free regimens. Objective: Assess the uptake of BCV and TVR across Europe from a health authority perspective to offer future guidance on dealing with new high cost medicines. Methods: Cross-sectional descriptive study of medicines to treat HCV (pegIEN, ribavirin, BCV and TVR) among European countries from 2008 to 2013. Utilization measured in defined daily doses (DDDs)/1000 patients/quarter (DIOs) and expenditure in Euros/DDD. Health authority activities to influence treatments categorized using the 4E methodology (Education, Engineering, Economics and Enforcement). Results: Similar uptake of BCV and TVR among European countries and regions, ranging from 0.5 DIQ in Denmark, Netherlands and Slovenia to 1.5 DIQ in Tayside and Catalonia in 2013. However, different utilization of the new Pls vs. ribavirin indicates differences in dual vs. triple therapy, which is down to factors including physician preference and genotypes. Reimbursed prices for BCV and TVR were comparable across countries. Conclusion: There was reasonable consistency in the utilization of BCV and TVR among European countries in comparison with other high priced medicines. This may reflect the social demand to limit the transmission of HCV. However, the situation is changing with new curative medicines for HCV genotype 1 (GT1) with potentially an appreciable budget impact. These concerns have resulted in different prices across countries, with their impact on budgets and patient outcomes monitored in the future to provide additional guidance.
30.	Degerman, Erik, et al. (författare) Jämför- och referensvärden från Svenskt Elfiskeregister - Perioden 2008-2015 2016 Rapport (övrigt vetenskapligt/konstnärligt)abstract Rapporten utgörs av en mängd tabellerade jämför- och referensvärden, från elfiskeundersökningar spridda över landet åren 2008-2015. Materialet har delats in efter avrinningsområdets storlek, geografisk region samt typ av öringpopulation (strömlevande, insjövandrande, havsvandrande) eller laxpopulation (insjövandrande (Vänern) eller havsvandrande). Förslag ges (avsnitt 4) på hur man kan använda detta referensmaterial för att jämföra med sina egna elfiskeundersökningar. De tätheter som anges utgör beräknade tätheter från elfisken utförda i de olika regionerna, det vill säga fältdata korrigerade för fångsteffektivitet genom antingen upprepade utfisken eller skattade fångsteffektiviteter. Tätheterna visar inte på beräknad potential/produktion vid opåverkade förhållanden. Jämförvärdena och referensvärdena ger en jämförelse med motsvarande vatten idag, med den status de för tillfället har.
31.	Domeika, Kristina, et al. (författare) Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells 2004 Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102 Tidskriftsartikel (refereegranskat)abstract The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
32.	Elkabets, Moshe, et al. (författare) Human tumors instigate granulin-expressing hematopoietic cells that promote malignancy by activating stromal fibroblasts in mice 2011 Ingår i: Journal of Clinical Investigation. - 0021-9738 .- 1558-8238. ; 121:2, s. 784-799 Tidskriftsartikel (refereegranskat)abstract Systemic instigation is a process by which endocrine signals sent from certain tumors (instigators) stimulate BM cells (BMCs), which are mobilized into the circulation and subsequently foster the growth of otherwise indolent carcinoma cells (responders) residing at distant anatomical sites. The identity of the BMCs and their specific contribution or contributions to responder tumor growth have been elusive. Here, we have demonstrated that Scal(+)cKit(-) hematopoietic BMCs of mouse hosts bearing instigating tumors promote the growth of responding tumors that form with a myofibroblast-rich, desmoplastic stroma. Such stroma is almost always observed in malignant human adenocarcinomas and is an indicator of poor prognosis. We then identified granulin (GRN) as the most upregulated gene in instigating Scal(+)cKit(-) BMCs relative to counterpart control cells. The GRN(+) BMCs that were recruited to the responding tumors induced resident tissue fibroblasts to express genes that promoted malignant tumor progression; indeed, treatment with recombinant GRN alone was sufficient to promote desmoplastic responding tumor growth. Further, analysis of tumor tissues from a cohort of breast cancer patients revealed that high GRN expression correlated with the most aggressive triple-negative, basal-like tumor subtype and reduced patient survival. Our data suggest that GRN and the unique hematopoietic BMCs that produce it might serve as novel therapeutic targets.
33.	Enkirch, Theresa, et al. (författare) Molecular epidemiology of community- and hospital-associated Clostridioides difficile infections in Jönköping, Sweden, October 2017-March 2018 2022 Ingår i: Acta Pathologica, Microbiologica et Immunologica Scandinavica (APMIS). - : Wiley. - 0903-4641 .- 1600-0463. ; 130:11, s. 661-670 Tidskriftsartikel (refereegranskat)abstract Clostridioides difficile infections (CDIs) in Sweden are mostly hospital-associated (HA) with limited knowledge regarding community-associated (CA) infections. Here, we investigated the molecular epidemiology of clinical isolates of CA-CDI and HA-CDI in a Swedish county. Data and isolates (n = 156) of CDI patients (n = 122) from Jonkoping county, October 2017-March 2018, were collected and classified as CA (without previous hospital care or onset <= 2 days after admission or >12 weeks after discharge from hospital) or HA (onset >3 days after hospital admission or within 4 weeks after discharge). Molecular characterization of isolates included PCR ribotyping (n = 156 isolates) and whole genome sequencing with single nucleotide polymorphisms (SNP) analysis (n = 53 isolates). We classified 47 patients (39%) as CA-CDI and 75 (61%) as HA-CDI. Between CA-CDI and HA-CDI patients, we observed no statistically significant differences regarding gender, age, 30-day mortality or recurrence. Ribotype 005 (RR 3.1; 95% CI: 1.79-5.24) and 020 (RR 2.5; 95% CI: 1.31-4.63) were significantly associated with CA-CDI. SNP analysis identified seven clusters (0-2 SNP difference) involving 17/53 isolates of both CA-CDI and HA-CDI. Molecular epidemiology differed between CA-CDI and HA-CDI and WGS analysis suggests transmission of CDI within and between hospitals and communities.
34.	Faarinen, Mikko, et al. (författare) Al-26 at the AMS facility in Lund 2004 Ingår i: Nuclear Instruments & Methods in Physics Research. Section B: Beam Interactions with Materials and Atoms. - : Elsevier BV. - 0168-583X. ; 223-24, s. 130-134 Tidskriftsartikel (refereegranskat)abstract To broaden the AMS programme in Lund by including Al studies, a new injector has been installed and tested at the 3 MV Pelletron accelerator. Detailed optical calculations have been performed to obtain maximum mass and energy resolution. The design of the injector, the improvement in the resolution compared to the old injector, as well as preliminary tests with a Al-26-beam, are presented. By using accelerator mass spectrometry (AMS) to measure the long-lived aluminium isotope Al-26 it has become possible to study the uptake, distribution and retention of aluminium in biological system under physiologically realistic conditions. Results from a pilot project on Al-26 in wheat plants are presented.
35.	Faarinen, Mikko, et al. (författare) Installation of a New Injector at the Lund Pelletron 2002 Ingår i: Proceedings of the XXIV SNEAP meeting, Lund, Sweden, 21-24 October, 2001. ; , s. 10-10 Konferensbidrag (refereegranskat)
36.	Farhangi, Mosen, et al. (författare) Planning Education and Transformative Capacity for Climate-Neutral Cities 2023 Ingår i: Journal of planning education and research. - : SAGE PUBLICATIONS INC. - 0739-456X .- 1552-6577. Tidskriftsartikel (refereegranskat)abstract To achieve their goal to become climate neutral, Swedish municipalities must significantly improve their transformative capacities. Adapting the roles and practices of urban planners is an important element in this process. This paper critically reflects on the way in which improved planning education may help to enable a new generation of planners to face the challenges of rapid urban transformation and provides them with the knowledge and tools needed for these new roles. The results suggest that there are interdependencies between the demand of municipalities for knowledge and skills and the capacity of educational programs for educating planners with transformative abilities.
37.	Framke, Elisabeth, et al. (författare) Contribution of income and job strain to the association between education and cardiovascular disease in 1.6 million Danish employees 2020 Ingår i: European Heart Journal. - : Oxford University Press (OUP). - 0195-668X .- 1522-9645. ; 41:11, s. 1164-1178 Tidskriftsartikel (refereegranskat)abstract Aims: We examined the extent to which associations between education and cardiovascular disease (CVD) morbidity and mortality are attributable to income and work stress.Methods and results: We included all employed Danish residents aged 30–59 years in 2000. Cardiovascular disease morbidity analyses included 1 638 270 individuals, free of cardiometabolic disease (CVD or diabetes). Mortality analyses included 41 944 individuals with cardiometabolic disease. We assessed education and income annually from population registers and work stress, defined as job strain, with a job-exposure matrix. Outcomes were ascertained until 2014 from health registers and risk was estimated using Cox regression. During 10 957 399 (men) and 10 776 516 person-years (women), we identified 51 585 and 24 075 incident CVD cases, respectively. For men with low education, risk of CVD was 1.62 [95% confidence interval (CI) 1.58–1.66] before and 1.46 (95% CI 1.42–1.50) after adjustment for income and job strain (25% reduction). In women, estimates were 1.66 (95% CI 1.61–1.72) and 1.53 (95% CI 1.47–1.58) (21% reduction). Of individuals with cardiometabolic disease, 1736 men (362 234 person-years) and 341 women (179 402 person-years) died from CVD. Education predicted CVD mortality in both sexes. Estimates were reduced with 54% (men) and 33% (women) after adjustment for income and job strain.Conclusion: Low education predicted incident CVD in initially healthy individuals and CVD mortality in individuals with prevalent cardiometabolic disease. In men with cardiometabolic disease, income and job strain explained half of the higher CVD mortality in the low education group. In healthy men and in women regardless of cardiometabolic disease, these factors explained 21–33% of the higher CVD morbidity and mortality.
38.	Fredholm, H., et al. (författare) Breast cancer in young women - age a risk factor only in those not given chemotherapy 2014 Ingår i: Breast. - 0960-9776 .- 1532-3080. ; 23:S1, s. S12-S12 Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)
39.	Fredholm, Hanna, et al. (författare) Breast cancer in young women and prognosis : How important are proliferation markers? 2017 Ingår i: European Journal of Cancer. - : Elsevier BV. - 0959-8049 .- 1879-0852. ; 84, s. 278-289 Tidskriftsartikel (refereegranskat)abstract Aim:Compared to middle-aged women, young women with breast cancer have a higher risk of systemic disease. We studied expression of proliferation markers in relation to age and subtype and their association with long-term prognosis.Methods:Distant disease-free survival (DDFS) was studied in 504 women aged <40 years and 383 women aged >= 40 years from a population-based cohort. Information on patient characteristics, treatment and follow-up was collected from medical records. Tissue microarrays were produced for analysis of oestrogen receptor, progesterone receptor (PR), Her2, Ki-67 and cyclins.Results: Young women with luminal tumours had significantly higher expression of Ki-67 and cyclins. Proliferation markers were prognostic only within this subtype. Ki-67 was a prognostic indicator only in young women with luminal PR+ tumours. The optimal cut-off for Ki-67 varied by age. High expression of cyclin E1 conferred a better DDFS in women aged <40 years with luminal PR- tumours (hazard ratio [HR] 0.47 [0.24-0.92]). Age < 40 years was an independent risk factor of DDFS exclusively in women with luminal B PR+ tumours (HR 2.35 [1.22-4.50]). Young women with luminal B PR- tumours expressing low cyclin E1 had a six-fold risk of distant disease compared with luminal A ( HR 6.21 [2.17-17.6]).Conclusions:The higher expression of proliferation markers in young women does not have a strong impact on prognosis. Ki-67 is only prognostic in the subgroup of young women with luminal PR tumours. The only cyclin adding prognostic value beyond subtype is cyclin E1. Age is an independent prognostic factor only in women with luminal B PR+ tumours.
40.	Fredholm, Hanna, et al. (författare) Long-term outcome in young women with breast cancer : a population-based study 2016 Ingår i: Breast Cancer Research and Treatment. - : Springer Science and Business Media LLC. - 0167-6806 .- 1573-7217. ; 160:1, s. 131-143 Tidskriftsartikel (refereegranskat)abstract Whether young age at diagnosis of breast cancer is an independent risk factor for death remains controversial, and the question whether young age should be considered in treatment decisions is still to be answered. From a population-based cohort of 22,017 women with breast cancer, all women < 35 years (n = 471) were compared to a random sample of 700 women aged 35-69 years from the same cohort. Information on patient and tumor characteristics, treatment, and follow-up was collected from the medical records. Tissue microarrays were produced for analysis of classical biomarkers. Breast cancer-specific survival (BCSS), distant disease-free survival (DDFS), and locoregional recurrence-free survival (LRFS) by age were compared using women 50-69 years as reference. At 10 years follow-up, women < 35 years and 35-39 years had a worse BCSS [age < 35 years 69 % (HR 2.75, 95 % CI 1.93-3.94), age 35-39 years 76 % (HR 2.33, 95 % CI 1.54-3.52), age 40-49 years 84 % (HR 1.53, 95 % CI 0.97-2.39), and age 50-69 years 89 % (reference)]. The worse BCSS was statistically significant in stages I-IIa and Luminal B tumors. At multivariate analysis age < 35 years and 35-39 years confined a risk in LRFS (HR 2.13, 95 % CI 1.21-3.76 and HR 1.97, 95 % CI 1.06-3.68) but not in DDFS and BCSS. In the subgroup of women < 40 years with luminal tumors stage I-IIa, low age remained an independent risk factor also in DDFS (HR 1.87, 95 % CI 1.03-3.44). Young women have a high risk of systemic disease even when diagnosed in an early stage. The excess risk of relapse is most pronounced in Luminal B tumors, where low age is an independent prognostic factor of DDFS and LRFS.
41.	Fredholm, Hanna, et al. (författare) Longterm outcomes in young women with breast cancer – low age a risk factor in luminal B tumors Tidskriftsartikel (övrigt vetenskapligt/konstnärligt)
42.	Furuhjelm, Catrin, et al. (författare) Allergic disease in infants up to 2 yr of age in relation to plasma omega-3 fatty acids and maternal fish oil supplementation inpregnancy and lactation 2011 Ingår i: Pediatric Allergy and Immunology. - : John Wiley & Sons A/S. - 0905-6157 .- 1399-3038. ; 22:5, s. 505-514 Tidskriftsartikel (refereegranskat)abstract We have previously reported a protective effect of maternal omega-3 long-chain polyunsaturated fatty acids (x-3 LCPUFA) supplementation in pregnancy and lactation on IgE-associated eczema and food allergy in the infant during the first year of life. Here we investigate whether the effects of the LCPUFA supplementation on IgE-associated diseases last up to 2 yr of age and assess the relationship between plasma proportions of x-3 PUFAs and the frequency and severity of infant allergic disease. 145 pregnant women, at risk of having an allergic infant, were randomized to daily supplementation with 1.6 g eicosapentaenoic acid (EPA) and 1.1 g docosahexaenoic acid (DHA) or placebo starting in the 25th gestational week and continuing through 3.5 months of breastfeeding. Clinical examinations, skin prick tests and analysis of maternal and infant plasma phospholipid fatty acids and infant specific IgE were performed. No difference in the prevalence of allergic symptoms was found between the intervention groups. Thecumulative incidence of IgE-associated disease was lower in the x-3-supplemented group (6/54, 13%) compared with the placebo group (19/62, 30%, p = 0.01). Higher maternal and infant proportions of DHA and EPA were associated with lower prevalence of IgE associated disease (p = 0.01–0.05) in a dose-dependent manner. Higher maternal and infant proportions of DHA and EPA were found if the infants presented none, when compared with multiple allergic symptoms, (p < 0.05) regardless of sensitization. In summary, the x-3 supplementation offered no obvious preventive effect on the prevalence of clinical symptoms of allergic disease, but the decrease in cumulative incidence of IgE-associated disease seen during the first year still remained until 2 yr of age. Furthermore, high proportions of DHA and EPA in maternal and infant plasma phospholipids were associated with less IgE-associated disease and a reduced severity of the allergic phenotype.
43.	Furuhjelm, Catrin, et al. (författare) Fish oil supplementation in pregnancy and lactation may decrease the risk of infant allergy 2009 Ingår i: Acta Paediatrica. - : Wiley. - 0803-5253 .- 1651-2227. ; 98:9, s. 1461-1467 Tidskriftsartikel (refereegranskat)abstract Maternal intake of omega-3 (-3) polyunsaturated fatty acids (PUFAs) during pregnancy has decreased, possibly contributing to a current increased risk of childhood allergy. Aim: To describe the effects of maternal -3 long-chain PUFA supplementation during pregnancy and lactation on the incidence of allergic disease in infancy. Methods: One hundred and forty-five pregnant women, affected by allergy themselves or having a husband or previous child with allergies, were included in a randomized placebo-controlled trial. Daily maternal supplementation with either 1.6 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid or placebo was given from the 25(th) gestational week to average 3-4 months of breastfeeding. Skin prick tests, detection of circulating specific immunoglobulin E (IgE) antibodies and clinical examinations of the infants were performed. Results: The period prevalence of food allergy was lower in the -3 group (1/52, 2%) compared to the placebo group (10/65, 15%, p andlt; 0.05) as well as the incidence of IgE-associated eczema (-3 group: 4/52, 8%; placebo group: 15/63, 24%, p andlt; 0.05). Conclusion: Maternal -3 fatty acid supplementation may decrease the risk of food allergy and IgE-associated eczema during the first year of life in infants with a family history of allergic disease.
44.	Gerdhem, Paul, et al. (författare) Bone mass cannot be predicted by estimations of frailty in elderly ambulatory women. 2003 Ingår i: Gerontology. - : S. Karger AG. - 1423-0003 .- 0304-324X. ; 49:3, s. 168-172 Tidskriftsartikel (refereegranskat)abstract <i>Background/Methods:</i> High biological age, or frailty, a possible risk factor for fragility fracture, and its relation to known risk factors for fracture (low bone mineral density (BMD), low muscle strength, poor gait performance and poor balance, previous falls, previous fractures and future risk of falls) were investigated in 993 randomly selected 75-year-old women. Frailty, which has no accepted definition, was here defined as a subjective immediate impression of an individual’s general health appearance and was transferred into an arbitrary scale. 993 individuals were scored by at least one of four observers. <i>Results:</i> The frailty score and BMD were not correlated. A high frailty score was significantly correlated to poor gait (r = 0.53–0.59, p < 0.0001), poor balance (r = –0.49, p < 0.0001), low muscle strength (r = –0.25 to –0.41, p < 0.0001), low activity level (r = –0.43, p < 0.0001) and a high risk of falling (r = 0.24, p < 0.0001). The group of women who had experienced at least one fall the previous year had a higher frailty score (p < 0.0001) compared to those who had not. Women who had sustained a hip or femoral fracture after the age of 70 had a higher frailty score than women with no earlier fracture at all. <i>Conclusions:</i> Bone mass cannot be predicted by our subjective frailty score in elderly, ambulant women. Since a high frailty score correlates with factors that affect or are likely to affect fall propensity, this could indicate that a high frailty score is a risk factor for fracture, independent of bone mass. Frailty may be regarded as a complex risk factor, including several assessments that can be objectively measured. Whether estimation of frailty is a method to improve the assessment of the patient at risk for a fragility fracture is yet to be proven and can only be shown in a prospective study of fracture occurrence.
45.	Gerdhem, Paul, et al. (författare) Ultrasound of the phalanges is not related to a previous fracture. A comparison between ultrasound of the phalanges, calcaneus, and DXA of the spine and hip in 75-year-old women. 2002 Ingår i: Journal of Clinical Densitometry. - 1094-6950. ; 5:2, s. 159-166 Tidskriftsartikel (refereegranskat)
46.	Goldhahn, Joakim, 1966-, et al. (författare) Förslaget till ändringar i kulturminneslagen håller inte! 2011 Ingår i: DIK Forum. - Nacka : DIK. ; :5, s. 19-20, s. 19-21 Tidskriftsartikel (populärvet., debatt m.m.)
47.	Grdic, Dubravka, 1968, et al. (författare) Splenic marginal zone dendritic cells mediate the cholera toxin adjuvant effect: dependence on the ADP-ribosyltransferase activity of the holotoxin. 2005 Ingår i: Journal of immunology (Baltimore, Md. : 1950). - 0022-1767. ; 175:8, s. 5192-202 Forskningsöversikt (refereegranskat)abstract The in vivo mechanisms of action of most vaccine adjuvants are poorly understood. In this study, we present data in mice that reveal a series of critical interactions between the cholera toxin (CT) adjuvant and the dendritic cells (DC) of the splenic marginal zone (MZ) that lead to effective priming of an immune response. For the first time, we have followed adjuvant targeting of MZ DC in vivo. We used CT-conjugated OVA and found that the Ag selectively accumulated in MZ DC following i.v. injections. The uptake of Ag into DC was GM1 ganglioside receptor dependent and mediated by the B subunit of CT (CTB). The targeted MZ DC were quite unique in their phenotype: CD11c(+), CD8alpha(-), CD11b(-), B220(-), and expressing intermediate or low levels of MHC class II and DEC205. Whereas CTB only delivered the Ag to MZ DC, the ADP-ribosyltransferase activity of CT was required for the maturation and migration of DC to the T cell zone, where these cells distinctly up-regulated CD86, but not CD80. This interaction appeared to instruct Ag-specific CD4(+) T cells to move into the B cell follicle and strongly support germinal center formations. These events may explain why CT-conjugated Ag is substantially more immunogenic than Ag admixed with soluble CT and why CTB-conjugated Ag can tolerize immune responses when given orally or at other mucosal sites.
48.	Grundel, Ida, PhD, 1979-, et al. (författare) Omställning av energisystem från ett kommunalt perspektiv : Planeringsutmaningar och strategier 2022 Ingår i: Kommunerna och hållbar utveckling. - Linköping : Linköping University Electronic Press. - 9789180750103 - 9789180750110 ; , s. 117-131 Bokkapitel (övrigt vetenskapligt/konstnärligt)
49.	Gunnarsson, Mikael, et al. (författare) Biokinetics and radiation dosimetry for patients undergoing a glycerol tri[1-14C]oleate fat malabsorption breath test. 2003 Ingår i: Applied Radiation and Isotopes. - 0969-8043. ; 58:4, s. 517-526 Tidskriftsartikel (refereegranskat)
50.	Gyllén, Jenny, 1968, et al. (författare) PECARE: Parental Feedback to Improve Congenital Cataract Care in Sweden 2023 Ingår i: Journal of Pediatric Ophthalmology & Strabismus. - : SLACK, Inc.. - 0191-3913 .- 1938-2405. ; 60:4, s. 288-294 Tidskriftsartikel (refereegranskat)abstract Purpose: To analyze non-directed parental feedback to health care providers responsible for pediatric cataract care in Sweden. Methods: A directed content analysis was used to analyze data consisting of text representing free comments provided by 40 parents. A deductive approach was employed by applying the model of balancing the child's inability and ability, which includes the categories mastering, collaborating, facilitating, and adapting. Results: Parents lacked piloting and self-management support. They experienced an absence of partnership with the health care team and not being taken seriously. They also felt abandoned by health care, resulting in emotional distress. Parents highlighted the impact of their social network and the challenges involved in accepting and adapting to the changes in everyday life. Conclusions: This study emphasizes the consequences of the lack of a caring partnership with health care professionals. Because parents act as mediators of care to the child with congenital cataract, persistence on the part of parents and a family-centered approach are essential for the child's visual development.

Skapa referenser, mejla, bekava och länka

Länka till träfflistan

Träfflista för sökning "WFRF:(Magnusson Kristina) "

Avgränsa träffmängd

År