| 1. |
- Beral, V, et al.
(författare)
-
Alcohol, tobacco and breast cancer - collaborative reanalysis of individual data from 53 epidemiological studies, including 58515 women with breast cancer and 95067 women without the disease
- 2002
-
Ingår i: British Journal of Cancer. - : Springer Science and Business Media LLC. - 1532-1827 .- 0007-0920. ; 87, s. 1234-45
-
Tidskriftsartikel (refereegranskat)abstract
- Alcohol and tobacco consumption are closely correlated and published results on their association with breast cancer have not always allowed adequately for confounding between these exposures. Over 80% of the relevant information worldwide on alcohol and tobacco consumption and breast cancer were collated, checked and analysed centrally. Analyses included 58515 women with invasive breast cancer and 95067 controls from 53 studies. Relative risks of breast cancer were estimated, after stratifying by study, age, parity and, where appropriate, women's age when their first child was born and consumption of alcohol and tobacco. The average consumption of alcohol reported by controls from developed countries was 6.0 g per day, i.e. about half a unit/drink of alcohol per day, and was greater in ever-smokers than never-smokers, (8.4 g per day and 5.0 g per day, respectively). Compared with women who reported drinking no alcohol, the relative risk of breast cancer was 1.32 (1.19 - 1.45, P < 0.00001) for an intake of 35 - 44 g per day alcohol, and 1.46 (1.33 - 1.61, P < 0.00001) for greater than or equal to 45 g per day alcohol. The relative risk of breast cancer increased by 7.1% (95% CI 5.5-8.7%; P<0.00001) for each additional 10 g per day intake of alcohol, i.e. for each extra unit or drink of alcohol consumed on a daily basis. This increase was the same in ever-smokers and never-smokers (7.1 % per 10 g per day, P < 0.00001, in each group). By contrast, the relationship between smoking and breast cancer was substantially confounded by the effect of alcohol. When analyses were restricted to 22 255 women with breast cancer and 40 832 controls who reported drinking no alcohol, smoking was not associated with breast cancer (compared to never-smokers, relative risk for ever-smokers= 1.03, 95% CI 0.98 - 1.07, and for current smokers=0.99, 0.92 - 1.05). The results for alcohol and for tobacco did not vary substantially across studies, study designs, or according to 15 personal characteristics of the women; nor were the findings materially confounded by any of these factors. If the observed relationship for alcohol is causal, these results suggest that about 4% of the breast cancers in developed countries are attributable to alcohol. In developing countries, where alcohol consumption among controls averaged only 0.4 g per day, alcohol would have a negligible effect on the incidence of breast cancer. In conclusion, smoking has little or no independent effect on the risk of developing breast cancer; the effect of alcohol on breast cancer needs to be interpreted in the context of its beneficial effects, in moderation, on cardiovascular disease and its harmful effects on cirrhosis and cancers of the mouth, larynx, oesophagus and liver. (C) 2002 Cancer Research UK.
|
|
| 2. |
- Magnusson, Mattias, et al.
(författare)
-
Importance of CpG dinucleotides in activation of natural IFN-alpha-producing cells by a lupus-related oligodeoxynucleotide
- 2001
-
Ingår i: Scandinavian Journal of Immunology. - : John Wiley & Sons. - 0300-9475 .- 1365-3083. ; 54:6, s. 543-550
-
Tidskriftsartikel (refereegranskat)abstract
- The oligodeoxyribonucleotide (ODN) 5-TTTTCAATTCGAAGATGAAT-3 (ODN H), identified in systemic lupus erythematosus (SLE) serum, induced the production of interferon (IFN)-alpha in human peripheral blood mononuclear cells (PBMC) when combined with lipofectin. Flow cytometric analysis with staining for surface antigens and intracellular IFN-alpha, showed that the IFN-alpha -producing cells (IPC) were the natural IPC, also termed type 2 dendritic cell precursors (pDC2) or plasmacytoid monocytes. The importance of unmethylated CpG dinucleotides for the interferogenic activity of ODN was studied. Methylation of CpG impaired the activity of single-stranded (ss) ODN H, but increased that of the complementary ssODN I. Furthermore, CpG-methylated double-stranded (ds) ODN H-met-I-met lost, but hemimethylated dsODN H-I-met retained interferogenic activity. Inversion of the CpG to GpC had no effect on the interferogenic activity of ssODN H, increased that of ssODN I, however abolished the activity of dsODN H-I. Alteration of the CpG in ODN H to ApG and in the ODN I to CpT destroyed their activity. The induction of IFN-alpha is therefore sequence-specific, but unmethylated CpGs are not always required, especially not in ssODNs. Interferogenic DNA sequences could therefore be more frequent in eukaryotic genomes than previously thought and their capacity to activate natural IPC may have implications for immune responses to microbial antigens and nuclear autoantigens.
|
|
| 3. |
|
|
| 4. |
- Blomberg, Stina, et al.
(författare)
-
Expression of the markers BDCA-2 and BDCA-4 and production of interferon-alpha by plasmacytoid dendritic cells in systemic lupus erythematosus
- 2003
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 48:9, s. 2524-32
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: To study the expression of blood dendritic cell antigen 2 (BDCA-2) and BDCA-4 molecules by plasmacytoid dendritic cells (PDCs) in the blood of patients with systemic lupus erythematosus (SLE), and to study PDC production of interferon-alpha (IFN alpha) and its inhibition by anti-BDCA-2 and anti-BDCA-4 antibodies. METHODS: Peripheral blood mononuclear cells (PBMCs) from SLE patients (SLE PBMCs) and from healthy controls were induced to produce IFN alpha in vitro by SLE serum containing an endogenous IFN alpha-inducing factor (SLE-IIF) or by herpes simplex virus type 1 (HSV-1). The frequencies and numbers of BDCA-2-, BDCA-3-, and BDCA-4-expressing cells were analyzed by flow cytometry, and the effects of anti-BDCA-2 and anti-BDCA-4 monoclonal antibodies (mAb) on IFN alpha production were investigated. RESULTS: IFN alpha production by SLE PBMCs induced by SLE-IIF or HSV-1 was decreased compared with that of healthy control PBMCs (P = 0.002 and P = 0.0007, respectively). The proportions of BDCA-2- and BDCA-3-expressing cells in SLE PBMCs were reduced compared with those in PBMCs from healthy controls (P = 0.01 and P = 0.004, respectively). IFN alpha producers in culture, especially among SLE PBMCs, displayed reduced BDCA-2 expression and constituted only a minority of the BDCA-2-positive cells, at least in healthy control PBMCs (median 18%). IFN alpha production by both SLE and healthy control PBMCs stimulated by SLE-IIF or HSV-1 was markedly reduced by anti-BDCA-2 mAb (median 81-98% inhibition). Anti-BDCA-4 mAb only partially inhibited SLE-IIF-induced IFN alpha production. CONCLUSION: SLE patients had a reduced number of BDCA-2-expressing PDCs, also termed natural IFN alpha-producing cells, and their IFN alpha production could be inhibited by anti-BDCA-2/4 mAb. Such mAb may be a therapeutic option for inhibiting the ongoing IFN alpha production in SLE patients.
|
|
| 5. |
- Båve, Ullvi, et al.
(författare)
-
Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG
- 2003
-
Ingår i: Journal of Immunology. - : American Association of Immunologists. - 0022-1767 .- 1550-6606. ; 171:6, s. 3296-302
-
Tidskriftsartikel (refereegranskat)abstract
- An ongoing production of IFN-alpha may be of etiopathogenic significance in systemic lupus erythematosus (SLE). It may be due to the natural IFN-producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), activated by immune complexes that contain nucleic acids derived from apoptotic cells. We here examined the role of FcgammaR in the IFN-alpha production in vitro by PBMC induced by the combination of apoptotic U937 cells and autoantibody-containing IgG from SLE patients (SLE-IgG). The Fc portion of the SLE-IgG was essential to induce IFN-alpha production, because Fab fragments or F(ab')(2) were ineffective. Normal, especially heat-aggregated, IgG inhibited the IFN-alpha production, suggesting a role for FcgammaR on PBMC. Using blocking anti-FcgammaR Abs, the FcgammaRIIa,c (CD32) but not FcgammaRI or FcgammaRIII were shown to be involved in the IFN-alpha induction by apoptotic cells combined with SLE-IgG, but not by HSV or CpG DNA. In contrast, the action of all of these inducers was inhibited by the anti-FcgammaRIIa,b,c mAb AT10 or heat-aggregated IgG. Flow cytometric analysis revealed that approximately 50% of the BDCA-2-positive PBMC, i.e., NIPC/PDC, expressed low but significant levels of FcgammaRII, as did most of the actual IFN-alpha producers activated by HSV. RT-PCR applied to NIPC/PDC purified by FACS demonstrated expression of FcgammaRIIa, but not of FcgammaRIIb or FcgammaRIIc. We conclude that FcgammaRIIa on NIPC/PDC is involved in the activation of IFN-alpha production by interferogenic immune complexes, but may also mediate inhibitory signals. The FcgammaRIIa could therefore have a key function in NIPC/PDC and be a potential therapeutic target in SLE.
|
|
| 6. |
|
|
| 7. |
- Domeika, Kristina, et al.
(författare)
-
Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
- 2004
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102
-
Tidskriftsartikel (refereegranskat)abstract
- The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
|
|
| 8. |
- Hagfeldt, A., et al.
(författare)
-
A system approach to molecular solar cells
- 2004
-
Ingår i: Coordination chemistry reviews. - : Elsevier BV. - 0010-8545 .- 1873-3840. ; 248:13-14, s. 1501-1509
-
Forskningsöversikt (refereegranskat)abstract
- This paper gives an overview of the research and development of dye-sensitized solar cells (DSC) within the Swedish research program 'Angstrom Solar Center'. A path towards low production cost is the development of a continuous process, which allows the production of solar cells in large volumes and with a high productivity. We have developed a deposition method for the production of the mesoporous TiO2, electrode layer that is based on compression of a powder film at room temperature. This technique allows us to use flexible substrates-a prerequisite fora continuous process. A novel interconnect technology, compatible with a continuous production process, is described. Stability data of plastic DSC, exposed to indoor light for more than 10,000 h, demonstrates the possibility for the technology to be explored for various types of indoor applications. Optimization of the DSC is a challenging task as it is a complex highly interacting molecular system. A system approach is proposed, where the complete DSC is investigated with a series of measurement techniques ('toolbox') that allows the study of the internal processes under relevant conditions. Two examples of such techniques are given.
|
|
| 9. |
|
|
| 10. |
|
|
