51. |
- North, Rachel A, et al.
(författare)
-
Structure and inhibition of N-acetylneuraminate lyase from methicillin-resistant Staphylococcus aureus
- 2016
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 590:23, s. 4414-4428
-
Tidskriftsartikel (refereegranskat)abstract
- N-Acetylneuraminate lyase is the first committed enzyme in the degradation of sialic acid by bacterial pathogens. In this study, we analyzed the kinetic parameters of N-acetylneuraminate lyase from methicillin-resistant Staphylococcus aureus (MRSA). We determined that the enzyme has a relatively high KM of 3.2 mm, suggesting that flux through the catabolic pathway is likely to be controlled by this enzyme. Our data indicate that sialic acid alditol, a known inhibitor of N-acetylneuraminate lyase enzymes, is a stronger inhibitor of MRSA N-acetylneuraminate lyase than of Clostridium perfringens N-acetylneuraminate lyase. Our analysis of the crystal structure of ligand-free and 2R-sialic acid alditol-bound MRSA N-acetylneuraminate lyase suggests that subtle dynamic differences in solution and/or altered binding interactions within the active site may account for species-specific inhibition.
|
|
52. |
|
|
53. |
|
|
54. |
|
|
55. |
|
|
56. |
|
|
57. |
- Wanrooij, Paulina H., et al.
(författare)
-
Ribonucleotides in mitochondrial DNA
- 2019
-
Ingår i: FEBS Letters. - : John Wiley & Sons. - 0014-5793 .- 1873-3468. ; 593:13, s. 1554-1565
-
Forskningsöversikt (refereegranskat)abstract
- The incorporation of ribonucleotides (rNMPs) into DNA during genome replication has gained substantial attention in recent years and has been shown to be a significant source of genomic instability. Studies in yeast and mammals have shown that the two genomes, the nuclear DNA (nDNA) and the mitochondrial DNA (mtDNA), differ with regard to their rNMP content. This is largely due to differences in rNMP repair - whereas rNMPs are efficiently removed from the nuclear genome, mitochondria lack robust mechanisms for removal of single rNMPs incorporated during DNA replication. In this minireview, we describe the processes that determine the frequency of rNMPs in the mitochondrial genome and summarise recent findings regarding the effect of incorporated rNMPs on mtDNA stability and function.
|
|
58. |
- Zabeo, Davide, 1992, et al.
(författare)
-
Axonemal doublet microtubules can split into two complete singlets in human sperm flagellum tips.
- 2019
-
Ingår i: FEBS letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 593:9, s. 892-902
-
Tidskriftsartikel (refereegranskat)abstract
- Motile flagella are crucial for human fertility and embryonic development. The distal tip of the flagellum is where growth and intra-flagellar transport are coordinated. In most model organisms, but not all, the distal tip includes a 'singlet region', where axonemal doublet microtubules (dMT) terminate and only complete A-tubules extend as singlet microtubules (sMT) to the tip. How a human flagellar tip is structured is unknown. Here, the flagellar tip structure of human spermatozoa was investigated by cryo-electron tomography, revealing the formation of a complete sMT from both the A-tubule and B-tubule of dMTs. This different tip arrangement in human spermatozoa shows the need to investigate human flagella directly in order to understand their role in health and disease.
|
|
59. |
- Zare, Aman, et al.
(författare)
-
The gut microbiome participates in transgenerational inheritance of low temperature responses in Drosophila melanogaster
- 2018
-
Ingår i: FEBS Letters. - : John Wiley & Sons. - 0014-5793 .- 1873-3468. ; 592:24, s. 4078-4086
-
Tidskriftsartikel (refereegranskat)abstract
- Environmental perturbations induce transcriptional changes, some of which may be inherited even in the absence of the initial stimulus. Previous studies have focused on transfers through the germ-line although microbiota is also passed on to the offspring. Thus, we inspected the involvement of the gut microbiome in transgenerational inheritance of environmental exposures in Drosophila melanogaster. We grew flies in the cold versus control temperatures and compared their transcriptional patterns in both conditions as well as in their offspring. F2 flies grew in control temperature while we controlled their microbiota acquisition from either F1 sets. Transcriptional status of some genes was conserved transgenerationally, and a subset of these genes, mainly expressed in the gut, was transcriptionally dependent on the acquired microbiome. This article is protected by copyright. All rights reserved.
|
|
60. |
- Zhao, Hongxing, et al.
(författare)
-
Adenovirus in the omics era - a multi-pronged strategy.
- 2020
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 594:12, s. 1879-1890
-
Tidskriftsartikel (refereegranskat)abstract
- Human adenoviruses (HAdVs) are common pathogens associated with a wide variety of respiratory, ocular and gastrointestinal diseases. To achieve its effective lytic mode of replication, HAdVs have to reprogram host-cell gene expression and fine-tune viral gene expression in a temporal manner. In two decades, omics revolution has advanced our knowledge about the HAdV and host cell interplay at the RNA and protein levels. This review summarizes the current knowledge from large-scale datasets how HAdV infections adjust coding and non-coding RNA expression, as well as how they reprogram host-cell proteome during the lytic course of infection.
|
|
61. |
- Abrahamson, Magnus, et al.
(författare)
-
Molecular cloning and sequence analysis of cDNA coding for the precursor of the human cysteine proteinase inhibitor cystatin C
- 1987
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 216:2, s. 229-233
-
Tidskriftsartikel (refereegranskat)abstract
- Recombinant cystatin C producing clones were isolated from a human placenta λgt11 cDNA library. The cDNA insert of one of the clones, containing 777 base pairs, encodes the complete mature cystatin C (120 amino acids) and a hydrophobic leader sequence of 26 amino acids, indicating an extracellular function of the inhibitor. The deduced protein sequence confirms the protein sequence of cystatin C isolated from human urine, but differs in one position from the sequence of the cystatin C fragment deposited as amyloid in hereditary cerebral hemorrhage with amyloidosis.
|
|
62. |
|
|
63. |
- Hederstedt, Lars, et al.
(författare)
-
Processing of Bacillus subtilis succinate dehydrogenase and cytochrome b-558 polypeptides
- 1987
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 213, s. 385-390
-
Tidskriftsartikel (refereegranskat)abstract
- The DNA sequence of the Bacillus subtilis sdh operon coding for the two succinate dehydrogenase subunits and cytochrome b-558 (the membrane anchor protein) has recently been established. We have now determined the extent of N-terminal processing of each polypeptide by radiosequence analysis. At the same time, direct evidence for the correctness of the predicted reading frames has been obtained. The cytochrome showed a ragged N-terminus, with forms lacking one residue, and is inserted across the membrane without an N-terminal leader-peptide. Covalently bound flavin was not detectable in B. subtilis succinate dehydrogenase expressed in Escherichia coli despite normal N-terminal processing of the apoprotein. This provides an explanation to why the succinate dehydrogenase synthesized in E. coli is not functional and demonstrates that host-specific factors regulate the coenzyme attachment.
|
|
64. |
- Karlsson, Maria, 1985, et al.
(författare)
-
Reconstitution of water channel function of an aquaporin overexpressed and purified from Pichia pastoris.
- 2003
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 537:1-3, s. 68-72
-
Tidskriftsartikel (refereegranskat)abstract
- The aquaporin PM28A is one of the major integral proteins in spinach leaf plasma membranes. Phosphorylation/dephosphorylation of Ser274 at the C-terminus and of Ser115 in the first cytoplasmic loop has been shown to regulate the water channel activity of PM28A when expressed in Xenopus oocytes. To understand the mechanisms of the phosphorylation-mediated gating of the channel the structure of PM28A is required. In a first step we have used the methylotrophic yeast Pichia pastoris for expression of the pm28a gene. The expressed protein has a molecular mass of 32462 Da as determined by matrix-assisted laser desorption ionization-mass spectrometry, forms tetramers as revealed by electron microscopy and is functionally active when reconstituted in proteoliposomes. PM28A was efficiently solubilized from urea- and alkali-stripped Pichia membranes by octyl-beta-D-thioglucopyranoside resulting in a final yield of 25 mg of purified protein per liter of cell culture.
|
|
65. |
|
|
66. |
|
|
67. |
- Persson, Daniel, 1972, et al.
(författare)
-
Penetratin-induced Aggregation and Subsequent Dissociation of Negatively Charged Phospholipid Vesicles
- 2001
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 505:2, s. 307-312
-
Tidskriftsartikel (refereegranskat)abstract
- The interaction of the cellular delivery vector penetratin with a model system consisting of negatively charged phospholipid vesicles has been studied. Above a certain peptide to lipid molar ratio, the cationic oligopeptide induces vesicle aggregation. Interestingly, the aggregation is followed by spontaneous disaggregation, which may be related to membrane translocation of the peptide. Circular dichroism (CD) measurements indicate a conformational transition, from alpha -helix to antiparallel beta -pleated sheet, which is simultaneous with the aggregation process. The potential influence of spectroscopic artifacts on CD data due to the drastically increased turbidity during aggregation is discussed.
|
|
68. |
- Selmane, T., et al.
(författare)
-
The L2 Loop Peptide of recA Stiffens and restricts Base Motions of Single-stranded DNA Similar to Intact Protein
- 1999
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 446:1, s. 30-34
-
Tidskriftsartikel (refereegranskat)abstract
- The L2 loop in the RecA protein is the catalytic center for DNA strand exchange, Here we investigate the DMA binding properties of the L2 loop peptide using optical spectroscopy with polarized light. Both fluorescence intensity and anisotropy of an etheno-modified poly(dA) increase upon peptide binding, indicate that the base motions of single-stranded DNA are restricted in the complex. In agreement with this conclusion, the peptide-poly(dT) complex exhibits a significant linear dichroism signal. The peptide is also found to modify the structure of double-stranded DNA, but does not denature it. It is inferred that strand separation may not be required for the formation of a joint molecule.
|
|
69. |
- Stenson, Lena, et al.
(författare)
-
Localization of hormone-sensitive lipase to rat Sertoli cells and its expression in developing and degenerating testes
- 1994
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 355:2, s. 125-130
-
Tidskriftsartikel (refereegranskat)abstract
- Using in situ hybridization, hormone-sensitive lipase was found to be expressed in a stage-dependent manner in Sertoli cells of rat testis. No expression was found in Leydig cells but expression in spermatids could not be excluded. These results suggest a role for hormone-sensitive lipase in the metabolism of lipid droplets in Sertoli cells, in contrast to its previously proposed function in steroid biosynthesis. The expression of testicular hormone-sensitive lipase mRNA and protein, both larger in size compared to other tissues, coincided with the onset of spermatogenesis and was dependent on scrotal localization of the testis, suggesting a temperature-dependent, pretranslational regulation of expression.
|
|
70. |
- Thoren, Per, 1972, et al.
(författare)
-
The Antennapedia peptide penetratin translocates across lipid bilayers - the first direct observation
- 2000
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 482:3, s. 265-268
-
Tidskriftsartikel (refereegranskat)abstract
- The potential use of polypeptides and oligonucleotides for therapeutical purposes has been questioned because of their inherently poor cellular uptake. However, the 16-mer oligopeptide penetratin, derived from the homeodomain of Antennapedia, has been reported to enter cells readily via a non-endocytotic and receptor- and transporter-independent pathway, even when conjugated to large hydrophilic molecules. We here present the first study where penetratin is shown to traverse a pure lipid bilayer. The results support the idea that the uptake mechanism involves only the interaction of the peptide with the membrane lipids. Furthermore, we conclude that the translocation does not involve pore formation.
|
|
71. |
- Wittung, Pernilla, 1968, et al.
(författare)
-
Fluorescence-detected interactions of oligonucleotides in RecA complexes
- 1995
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 368:1, s. 64-68
-
Tidskriftsartikel (refereegranskat)abstract
- A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA, The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible, The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed, In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur.
|
|
72. |
- Wittung, Pernilla, 1968, et al.
(författare)
-
Phospholipid membrane permeability of peptide nucleic acid
- 1995
-
Ingår i: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 365:1, s. 27-29
-
Tidskriftsartikel (refereegranskat)abstract
- Phospholipid vesicles (liposomes) as membrane models have been used to study the penetration properties of peptide nucleic acid (PNA), a new DNA analog in which the nucleobases are attached to a pseudo-peptide backbone, The liposomes were characterised by carboxyfluorescein efflux, light-scattering and cryogenic transmission electron microscopy. The liposome structure was found not to be affected by the incorporation of PNA or an oligonucleotide. Two 10-mer fluorescein-labelled PNAs were found to have low efflux rates (half-times of 5.5 and 11 days), comparable to a 10-mer oligonucleotide (half-time of 7 days). We conclude that passive diffusion of unmodified PNA is not an effective way of transport into biological cells.
|
|
73. |
- Abdulkarim, Farhad, et al.
(författare)
-
Mutations to kirromycin resistance occur in the interface of domains I and III of EF-Tu.GTP
- 1994
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 352, s. 118-122
-
Tidskriftsartikel (refereegranskat)abstract
- The antibiotic kirromycin inhibits protein synthesis by binding to EF-Tu and preventing its release from the ribosome after GTP hydrolysis.We have isolated and sequenced a collection of kirromycin resistant tuf mutations and identified thirteen single amino acid substitutions at sevendifferent sites in EF-Tu. These have been mapped onto the 3D structures of EF-Tu’GTP and EF-Tu.GDP. In the active GTP form of EF-Tu themutations cluster on each side of the interface between domains I and III. We propose that this domain interface is the binding site for kirromycin.
|
|
74. |
|
|
75. |
- Bläckberg, Lars, et al.
(författare)
-
Bile salt-stimulated lipase in human milk. Evidence that bile salt induces lipid binding and activation via binding to different sites.
- 1993
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 323:3, s. 207-210
-
Tidskriftsartikel (refereegranskat)abstract
- Human milk bile salt-stimulated lipase ensures efficient triacylglycerol utilization in breast-fed newborns. For activity against long-chain triacylglycerol, primary bile salts are a prerequisite. Bile salts also protect the enzyme from inactivation by intestinal proteases. We have studied the effect of different bile salts on activation, protease protection, lipid binding, and enzyme inactivation, caused by an arginine modifying agent. Based on the results we propose a model involving two bile salt binding sites; one activation-site specific for primary bile salt, and another, less specific, lipid binding promoting site at which also secondary bile salt binds. Binding to this latter site induces binding of enzyme to emulsified substrates but binding promoting site at which also secondary bile salt binds. Binding to this latter site induces binding of enzyme to emulsified substrates but without subsequent lipolysis.
|
|
76. |
- Chang, Shu-Nu, 1975-, et al.
(författare)
-
An acidic amino acid cluster regulates the nucleolar localization and ribosome assembly of human ribosomal protein L22
- 2000
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 484:1, s. 22-28
-
Tidskriftsartikel (refereegranskat)abstract
- The control of human ribosomal protein L22 (rpL22) to enter into the nucleolus and its ability to be assembled into the ribosome is regulated by its sequence. The nuclear import of rpL22 depends on a classical nuclear localization signal of four lysines at positions 13-16. RpL22 normally enters the nucleolus via a compulsory sequence of KKYLKK (I-domain, positions 88-93). An acidic residue cluster at the C-terminal end (C-domain) plays a nuclear retention role. The retention is concealed by the N-domain (positions 1-9) which weakly interacts with the C-domain as demonstrated in the yeast two-hybrid system. Once it reaches the nucleolus, the question of whether rpL22 is assembled into the ribosome depends upon the presence of the N-domain. This suggests that the N-domain, on dissociation from its interaction with the C-domain, binds to a specific region of the 28S rRNA for ribosome assembly.
|
|
77. |
|
|
78. |
|
|
79. |
- Gavel, Ylva, et al.
(författare)
-
A conserved cleavage-site motif in chloroplast transit peptides
- 1990
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 261:2, s. 455-458
-
Tidskriftsartikel (refereegranskat)abstract
- A collection of 32 stroma-targeting chloroplast transit peptides with known cleavage sites have been analysed in terms of amino acid preferences in the vicinity of the processing site. A loosely conserved consensus motif (Val/Ile)-X-(Ala/Cys)↓Ala is found in the majority of the transit peptides. About 30% of the sequences have a perfect match to the consensus. When such a match is found, there is a 90% probability that it specifies the correct cleavage site.
|
|
80. |
|
|
81. |
- Islam, M. Shahidul, et al.
(författare)
-
Ca(2+)-induced Ca2+ release in insulin-secreting cells
- 1992
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 296:3, s. 287-291
-
Tidskriftsartikel (refereegranskat)abstract
- The sulphydryl reagent thimerosal (50 microM) released Ca2+ from a non-mitochondrial intracellular Ca2+ pool in a dose-dependent manner in permeabilized insulin-secreting RINm5F cells. This release was reversed after addition of the reducing agent dithiothreitol. Ca2+ was released from an Ins(1,4,5)P3-insensitive pool, since release was observed even after depletion of the Ins(1,4,5)P3-sensitive pool by a supramaximal dose of Ins(2,4,5)P3 or thapsigargin. The Ins(1,4,5)P3-sensitive pool remained essentially unaltered by thimerosal. Thimerosal-induced Ca2+ release was potentiated by caffeine. These findings suggest the existence of Ca(2+)-induced Ca2+ release also in insulin-secreting cells.
|
|
82. |
- Jonsson, AP, et al.
(författare)
-
A novel Ser O-glucuronidation in acidic proline-rich proteins identified by tandem mass spectrometry.
- 2000
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 475:2, s. 131-4
-
Tidskriftsartikel (refereegranskat)abstract
- Human acidic proline-rich salivary protein PRP-1 and its C-terminally truncated form PRP-3 were analyzed by electrospray tandem mass spectrometry. Post-translational modifications were detected and characterized. A pyroglutamic acid residue was demonstrated at the N-terminus, Ser-8 and Ser-22 were shown to be phosphorylated and an O-linked glucuronic acid conjugation was identified. The latter modification was located to Ser-17 and found to be present in approximately 40% of the polypeptides.
|
|
83. |
|
|
84. |
|
|
85. |
|
|
86. |
- Padilla, C. A., et al.
(författare)
-
High-level expression of fully active human glutaredoxin (thioltransferase) in E. coli and characterization of Cys7 to Ser mutant protein
- 1996
-
Ingår i: FEBS Letters. - : Elsevier. - 0014-5793 .- 1873-3468. ; 378:1, s. 69-73
-
Tidskriftsartikel (refereegranskat)abstract
- Glutaredoxin (Grx) (12 kDa) is a hydrogen donor for ribonucleotide reductase and also a general GSH-disulfide reductase of importance for redox regulation. To overexpress human glutaredoxin in Escherichia coli, a cDNA encoding human Grx was modified and cloned into the vector pET-3d and expressed in E. coli BL21 (DE3) by IPTG induction. High-level expression of Grx was verified by GSH-disulfide oxidoreductase activity, SDS-PAGE and immunoblotting analysis. The recombinant human Grx in its reduced form was purified to homogenity with 50% yield and exhibited the same dehydroascorbate reductase and hydrogen donor activity for ribonucleotide reductase (Km approximately 0.2 microM) as the human placenta protein. Human Grx contains a total of 5 half-cystine residues including a non-conserved Cys7 residue and is easily oxidized to form dimers during storage. A Grx mutant Cys7 to Ser was generated by site-directed mutagenesis and the protein was purified to homogeneity. The mutant protein showed full activity and exhibited a much reduced tendency to form dimers compared with the wild type protein. Peptide sequencing confirmed the mutation and removal of the N-terminal Met residue in both wild type and mutant proteins. Fluorescence spectra demonstrated only tyrosine fluorescence in human Grx with a peak at 310 nm which increased 20% upon reduction and decreased by addition of GSSG demonstrating that glutathione-containing disulfides are excellent substrates.
|
|
87. |
- Principato, Giovanni B, et al.
(författare)
-
Relaxed thiol substrate specificity of glutathione transferase effected by a non-substrate glutathione derivative
- 1988
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 231:1, s. 155-158
-
Tidskriftsartikel (refereegranskat)abstract
- Rat glutathione transferase 4-4 catalysed the conjugation of 2-mercaptoethanol with 1-chloro-2,4-dinitrobenzene in the presence of S-methyl-glutathione. The reaction was linearly dependent on enzyme concentration and saturation was seen with respect to both 2-mercaptoethanol and S-methyl-glutathione concentration. High concentrations of S-methyl-gluta-thione were inhibitory. The results suggest that the natural substrate glutathione has two distinct functions in the normal catalytic reaction, (i) induction of a catalytically competent conformation of the enzyme and (ii) provision of the substrate sulfhydryl group in the reaction catalyzed.
|
|
88. |
- RAICES, M, et al.
(författare)
-
Cloning and characterization of a cDNA encoding a cellobiose dehydrogenase from the white rot fungus Phanerochaete chrysosporium
- 1995
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 369:2-3, s. 233-238
-
Tidskriftsartikel (refereegranskat)abstract
- The cDNA of cellobiose dehydrogenase (CDH) from Phanerochaete chrysosporium has been cloned and sequenced. The 5′ end was obtained by PCR amplification. The cDNA contains 2310 translated bases excluding the poly(A) tail. The deduced mature protein contains 770 amino acid residues and is preceded by a 18 residue long signal peptide. The regions of the amino acid sequence corresponding to the heme and FAD domains of CDH were identified as well as the nucleotide-binding motif, the disulfide pairing and a methionine residue chelating the heme iron. No homologous sequences were found for the heme domain, however, the FAD domain appears to be distantly related to the GMC oxidoreductase family.
|
|
89. |
- Röhrig, Ursula, et al.
(författare)
-
Coactosin interferes with the capping of actin filaments
- 1995
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 374:2, s. 284-286
-
Tidskriftsartikel (refereegranskat)abstract
- Coactosin, a 16 kDa protein associated with the actin cytoskeleton from Dictyostelium discoideum, was purified by an improved method, in which other components of the cytoskeleton were removed. The highly purified coactosin had no effect on the time course of actin polymerization, but when added to actin in presence of capping proteins, coactosin counteracted the capping activity of these proteins. The capping proteins cap32/34 and severin domain 1 retarded actin polymerization, on addition of coactosin to samples containing one of these capping proteins the time course of actin polymerization became close to controls without capping proteins.
|
|
90. |
|
|
91. |
- Syvänen, Ann-Christine, et al.
(författare)
-
Direct sequencing of affinity-captured amplified human DNA application to the detection of apolipoprotein E polymorphism
- 1989
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 258:1, s. 71-74
-
Tidskriftsartikel (refereegranskat)abstract
- We describe a method for the direct sequencing of DNA amplified by the polymerase chain reaction (PCR). Biotin is introduced into one strand of the amplified DNA using a 5'-biotinylated PCR primer. The synthesized fragment is captured on an avidin-matrix and rendered single stranded, whereafter the nucleotide sequence of the immobilized strand is determined by the chain termination method. The method involves few and simple operations and is thus applicable to the analysis of human genes for routine diagnostic purposes. Here we applied the method for determination of the three-allelic polymorphism of the apolipoprotein E (apo E) gene. We were able to correctly identify the alleles in both homozygous and heterozygous samples.
|
|
92. |
- Björkholm, Patrik, et al.
(författare)
-
Why mitochondria need a genome revisited
- 2017
-
Ingår i: FEBS Letters. - : WILEY-BLACKWELL. - 0014-5793 .- 1873-3468. ; 591:1, s. 65-75
-
Tidskriftsartikel (refereegranskat)abstract
- In this paper, we experimentally address the debate about why functional transfer of mitochondrial genes to the nucleus has been halted in some organismal groups and why cytosolic expression of mitochondrial proteins has proven remarkably difficult. By expressing all 13 human mitochondrial-encoded genes with strong mitochondrial-targeting sequences in the cytosol of human cells, we show that all proteins, except ATP8, are transported to the endoplasmic reticulum (ER). These results confirm and extend previous findings based on three mitochondrial genes lacking mitochondrial-targeting sequences that also were relocated to the ER during cytosolic expression. We conclude that subcellular protein targeting constitutes a major barrier to functional transfer of mitochondrial genes to the nuclear genome.
|
|
93. |
- Carlström, Andreas, 1988, et al.
(författare)
-
Insights into conformational changes in cytochrome b during the early steps of its maturation
- 2024
-
Ingår i: FEBS LETTERS. - 0014-5793 .- 1873-3468. ; 598:11, s. 1438-1448
-
Tidskriftsartikel (refereegranskat)abstract
- Membrane proteins carrying redox cofactors are key subunits of respiratory chain complexes, yet the exact path of their folding and maturation remains poorly understood. Here, using cryo-EM and structure prediction via Alphafold2, we generated models of early assembly intermediates of cytochrome b (Cytb), a central subunit of complex III. The predicted structure of the first assembly intermediate suggests how the binding of Cytb to the assembly factor Cbp3-Cbp6 imposes an open configuration to facilitate the acquisition of its heme cofactors. Moreover, structure predictions of the second intermediate indicate how hemes get stabilized by binding of the assembly factor Cbp4, with a concomitant weakening of the contact between Cbp3-Cbp6 and Cytb, preparing for the release of the fully hemylated protein from the assembly factors.
|
|
94. |
- Cicirò, Ylenia, et al.
(författare)
-
The mitotic checkpoint kinase BUB1 is a direct and actionable target of MYB in adenoid cystic carcinoma
- 2024
-
Ingår i: FEBS Letters. - 0014-5793 .- 1873-3468. ; 598:2, s. 252-265
-
Tidskriftsartikel (refereegranskat)abstract
- Adenoid cystic carcinoma (ACC) is a head and neck cancer that frequently originates in salivary glands, but can also strike other exocrine glands such as the breast. A key molecular alteration found in the majority of ACC cases is MYB gene rearrangements, leading to activation of the oncogenic transcription factor MYB. In this study, we used immortalised breast epithelial cells and an inducible MYB transgene as a model of ACC. Molecular profiling confirmed that MYB-driven gene expression causes a transition into an ACC-like state. Using this new cell model, we identified BUB1 as a targetable kinase directly controlled by MYB, whose pharmacological inhibition caused MYB-dependent synthetic lethality, growth arrest and apoptosis of patient-derived cells and organoids.
|
|
95. |
- Dimarogona, Maria, et al.
(författare)
-
The crystal structure of a Fusarium oxysporum feruloyl esterase that belongs to the tannase family
- 2020
-
Ingår i: FEBS Letters. - : John Wiley & Sons. - 0014-5793 .- 1873-3468. ; 594:11, s. 1738-1749
-
Tidskriftsartikel (refereegranskat)abstract
- Feruloyl esterases are enzymes of industrial interest that catalyse the hydrolysis of the ester bond between hydroxycinnamic acids such as ferulic acid and sugars present in the plant cell wall. Although there are several structures of biochemically characterized feruloyl esterases available, the structural determinants of their substrate specificity are not yet fully understood. Here, we present the crystal structure of a feruloyl esterase from Fusarium oxysporum (FoFaeC) at 2.3 Å resolution. Similar to the two other tannase‐like feruloyl esterases, FoFaeC features a large lid domain covering the active site with potential regulatory role and a disulphide bond that brings together the serine and histidine of the catalytic triad. Differences are mainly observed in the metal coordination site and the substrate binding pocket.
|
|
96. |
- Haase, Robert, et al.
(författare)
-
A Hitchhiker's guide through the bio‐image analysis software universe
- 2022
-
Ingår i: FEBS Letters. - : John Wiley & Sons. - 0014-5793 .- 1873-3468. ; 596:19, s. 2472-2485
-
Forskningsöversikt (refereegranskat)abstract
- Modern research in the life sciences is unthinkable without computational methods for extracting, quantifying and visualising information derived from microscopy imaging data of biological samples. In the past decade, we observed a dramatic increase in available software packages for these purposes. As it is increasingly difficult to keep track of the number of available image analysis platforms, tool collections, components and emerging technologies, we provide a conservative overview of software that we use in daily routine and give insights into emerging new tools. We give guidance on which aspects to consider when choosing the platform that best suits the user's needs, including aspects such as image data type, skills of the team, infrastructure and community at the institute and availability of time and budget.
|
|
97. |
- Hu, Min, et al.
(författare)
-
Overactivation of the androgen receptor exacerbates gravid uterine ferroptosis via interaction with and suppression of the NRF2 defense signaling pathway.
- 2022
-
Ingår i: FEBS letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 596:8, s. 806-825
-
Tidskriftsartikel (refereegranskat)abstract
- The mechanisms through which the androgen-dependent activation of the androgen receptor (AR) regulates graviduterine ferroptosis remain unknown.We show that whileco-exposure of pregnant rats to the androgen 5α-dihydrotestosterone (DHT) and insulin (INS)triggereduterineferroptotic signaling cascades,additional treatment with the anti-androgenflutamide increasedexpression of the key ferroptosis-inhibitory proteins SLC7A11, GSH, and GPX4, reduced iron content, normalized levels offerroptosis-associated Tfrc,Fpn1, andHo1mRNAs, reduced levels of proteins modified by 4-HNE (a marker of ferroptosis), andrestored protein levels of NRF2, a key transcription factor regulating antioxidant defense signaling, in the gravid uterus.Furthermore,exposure to DHT aloneincreaseduterine ferroptosis, and NRF2 abundance was negatively correlated withAR status.Co-immunoprecipitation and Western blot assays revealed that the AR physically interacted with endogenous NRF2, and this interaction was increased by DHT exposurein vivo.Our results suggest that AR overactivation and NRF2 suppression cooperate in the regulation ofNRF2-targets in uterine ferroptosis.
|
|
98. |
- Isidor, Marie S., et al.
(författare)
-
Pyruvate kinase M2 represses thermogenic gene expression in brown adipocytes
- 2020
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 594:7, s. 1218-1225
-
Tidskriftsartikel (refereegranskat)abstract
- Utilizing the thermogenic capacity of brown adipose tissue is a potential anti-obesity strategy; therefore, the mechanisms controlling expression of thermogenesis-related genes are of interest. Pyruvate kinase (PK) catalyzes the last step of glycolysis and exists as four isoenzymes: PK, liver, PK, red blood cell, PK, muscle (PKM1 and PKM2). PKM2 has both glycolytic and nuclear functions. Here, we report that PKM2 is enriched in brown adipose compared with white adipose tissue. Specific knockdown of PKM2 in mature brown adipocytes demonstrates that silencing of PKM2 does not lead to a decrease in PK activity, but causes a robust upregulation of thermogenic uncoupling protein 1 (Ucp1) and fibroblast growth factor 21 (Fgf21) gene expression. This increase is not mediated by any of the known mechanisms for PKM2-regulated gene expression, thus implying the existence of a novel mechanism for PKM2-dependent effects on gene expression.
|
|
99. |
- Košenina, Sara, et al.
(författare)
-
Crystal structure of the OrfX1–OrfX3 complex from the PMP1 neurotoxin gene cluster
- 2023
-
Ingår i: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 597:4, s. 515-523
-
Tidskriftsartikel (refereegranskat)abstract
- Paraclostridial mosquitocidal protein 1 (PMP1) is a member of the clostridial neurotoxin (CNT) family, which includes botulinum and tetanus neurotoxins. PMP1 has unique selectivity for anopheline mosquitos and is the only known member of the family that targets insects. PMP1 is encoded in an orfX gene cluster, which in addition to the toxin, consists of OrfX1, OrfX2, OrfX3, P47 and NTNH, which have been shown to aid in PMP1 toxicity. We here show that OrfX1 and OrfX3 form a complex and present its structure at 2.7 Å. The OrfX1–OrfX3 complex mimics the structure of full-length OrfX2 and belongs to the lipid-binding TULIP protein superfamily. With this report, the structures of all proteins encoded in the orfX gene cluster of CNTs are now determined.
|
|
100. |
- Mazurkewich, Scott, 1982, et al.
(författare)
-
A unique AA5 alcohol oxidase fused with a catalytically inactive CE3 domain from the bacterium Burkholderia pseudomallei
- 2023
-
Ingår i: FEBS Letters. - 1873-3468 .- 0014-5793. ; 597:13, s. 1779-1791
-
Tidskriftsartikel (refereegranskat)abstract
- Copper radical oxidases (CROs) are redox enzymes able to oxidize alcohols or aldehydes, while only requiring a single copper atom as cofactor. Studied CROs are found in one of two subfamilies within the Auxiliary Activities family 5 (AA5) in the carbohydrate-active enzymes database. We here characterize an AA5 enzyme outside the subfamily classification from the opportunistic bacterial pathogen Burkholderia pseudomallei, which curiously was fused to a carbohydrate esterase family 3 domain. The enzyme was shown to be a promiscuous primary alcohol oxidase, with an activity profile similar to enzymes from subfamily 2. The esterase domain was inactive on all tested substrates, and structural predictions revealed this being an effect of crippling substitutions in the expected active site residues.
|
|