| 1. |
- Blomberg, Stina, et al.
(författare)
-
Expression of the markers BDCA-2 and BDCA-4 and production of interferon-alpha by plasmacytoid dendritic cells in systemic lupus erythematosus
- 2003
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 48:9, s. 2524-32
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: To study the expression of blood dendritic cell antigen 2 (BDCA-2) and BDCA-4 molecules by plasmacytoid dendritic cells (PDCs) in the blood of patients with systemic lupus erythematosus (SLE), and to study PDC production of interferon-alpha (IFN alpha) and its inhibition by anti-BDCA-2 and anti-BDCA-4 antibodies. METHODS: Peripheral blood mononuclear cells (PBMCs) from SLE patients (SLE PBMCs) and from healthy controls were induced to produce IFN alpha in vitro by SLE serum containing an endogenous IFN alpha-inducing factor (SLE-IIF) or by herpes simplex virus type 1 (HSV-1). The frequencies and numbers of BDCA-2-, BDCA-3-, and BDCA-4-expressing cells were analyzed by flow cytometry, and the effects of anti-BDCA-2 and anti-BDCA-4 monoclonal antibodies (mAb) on IFN alpha production were investigated. RESULTS: IFN alpha production by SLE PBMCs induced by SLE-IIF or HSV-1 was decreased compared with that of healthy control PBMCs (P = 0.002 and P = 0.0007, respectively). The proportions of BDCA-2- and BDCA-3-expressing cells in SLE PBMCs were reduced compared with those in PBMCs from healthy controls (P = 0.01 and P = 0.004, respectively). IFN alpha producers in culture, especially among SLE PBMCs, displayed reduced BDCA-2 expression and constituted only a minority of the BDCA-2-positive cells, at least in healthy control PBMCs (median 18%). IFN alpha production by both SLE and healthy control PBMCs stimulated by SLE-IIF or HSV-1 was markedly reduced by anti-BDCA-2 mAb (median 81-98% inhibition). Anti-BDCA-4 mAb only partially inhibited SLE-IIF-induced IFN alpha production. CONCLUSION: SLE patients had a reduced number of BDCA-2-expressing PDCs, also termed natural IFN alpha-producing cells, and their IFN alpha production could be inhibited by anti-BDCA-2/4 mAb. Such mAb may be a therapeutic option for inhibiting the ongoing IFN alpha production in SLE patients.
|
|
| 2. |
|
|
| 3. |
- Båve, Ullvi, et al.
(författare)
-
Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG
- 2003
-
Ingår i: Journal of Immunology. - : American Association of Immunologists. - 0022-1767 .- 1550-6606. ; 171:6, s. 3296-302
-
Tidskriftsartikel (refereegranskat)abstract
- An ongoing production of IFN-alpha may be of etiopathogenic significance in systemic lupus erythematosus (SLE). It may be due to the natural IFN-producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), activated by immune complexes that contain nucleic acids derived from apoptotic cells. We here examined the role of FcgammaR in the IFN-alpha production in vitro by PBMC induced by the combination of apoptotic U937 cells and autoantibody-containing IgG from SLE patients (SLE-IgG). The Fc portion of the SLE-IgG was essential to induce IFN-alpha production, because Fab fragments or F(ab')(2) were ineffective. Normal, especially heat-aggregated, IgG inhibited the IFN-alpha production, suggesting a role for FcgammaR on PBMC. Using blocking anti-FcgammaR Abs, the FcgammaRIIa,c (CD32) but not FcgammaRI or FcgammaRIII were shown to be involved in the IFN-alpha induction by apoptotic cells combined with SLE-IgG, but not by HSV or CpG DNA. In contrast, the action of all of these inducers was inhibited by the anti-FcgammaRIIa,b,c mAb AT10 or heat-aggregated IgG. Flow cytometric analysis revealed that approximately 50% of the BDCA-2-positive PBMC, i.e., NIPC/PDC, expressed low but significant levels of FcgammaRII, as did most of the actual IFN-alpha producers activated by HSV. RT-PCR applied to NIPC/PDC purified by FACS demonstrated expression of FcgammaRIIa, but not of FcgammaRIIb or FcgammaRIIc. We conclude that FcgammaRIIa on NIPC/PDC is involved in the activation of IFN-alpha production by interferogenic immune complexes, but may also mediate inhibitory signals. The FcgammaRIIa could therefore have a key function in NIPC/PDC and be a potential therapeutic target in SLE.
|
|
| 4. |
- Båve, Ullvi
(författare)
-
Mechanisms of Interferon-α Induction in Systemic Lupus Erythematosus
- 2003
-
Doktorsavhandling (övrigt vetenskapligt/konstnärligt)abstract
- Patients with systemic lupus erythematosus (SLE) have an activated type I interferon (IFN) system with an ongoing IFN-α synthesis. This may be caused by circulating immune complexes, consisting of anti-DNA antibodies (Abs) and DNA, with IFN-α inducing capacity. Produced IFN-α may be crucial in the pathogenesis, because this cytokine can break tolerance and promote autoimmunity.In the present thesis, possible mechanisms of the IFN-α production in SLE were studied. To investigate whether IFN-α inducing material could be derived from apoptotic cells, IgG from SLE patients (SLE-IgG) were combined with apoptotic cells. This combination induced high IFN-α production in normal peripheral blood mononuclear cells (PBMC). The IFN-α induction was associated to presence of anti-RNP Abs, but not to anti-dsDNA Abs, indicating that two inducers could be active in SLE, one containing DNA and the other RNA.Apoptotic cells and SLE-IgG exclusively activated the natural interferon producing cells (NIPC) and the IFN-α response was enhanced by type I IFN and inhibited by IL-10 and TNF-α. The IFN-α induction was dependent on FcγRII, because blocking this receptor reduced IFN-α production and NIPC were found to express FcγRIIa.To further elucidate the role of different autoantibodies in the IFN-α induction, sera from patients with Sjögren´s syndrome (SS), containing autoantibodies to RNA binding proteins (SSA, SSB, RNP and/or Sm) were investigated. The combination of SS or SLE sera and apoptotic or necrotic cell material induced high IFN-α production in PBMC. RNA, but not DNA, was required for IFN-α induction, indicating that RNA and Abs to RNA-binding proteins form potent IFN-α inducing complexes.The findings in this thesis can explain central mechanisms for the activation of NIPC in SLE, and perhaps also other autoimmune diseases. This activation is mediated by interferogenic immune complexes, and modulating the NIPC activation may be a novel therapeutic approach in SLE.
|
|
| 5. |
|
|
| 6. |
- Domeika, Kristina, et al.
(författare)
-
Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
- 2004
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102
-
Tidskriftsartikel (refereegranskat)abstract
- The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
|
|
| 7. |
- Lövgren, Tanja, et al.
(författare)
-
Induction of interferon-α production in plasmacytoid dendritic cells by immune complexes containing nucleic acid released by necrotic or late apoptotic cells and lupus IgG
- 2004
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 50:6, s. 1861-1872
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: To investigate the release of interferon-alpha (IFN alpha)-inducing material by necrotic or apoptotic cells, its properties, and the necessity of autoantibodies from systemic lupus erythematosus (SLE) patients for the interferogenic activity. METHODS: U937 monocytic leukemia cells or peripheral blood mononuclear cells (PBMCs) were rendered necrotic by freeze-thawing or apoptotic by treatment with ultraviolet light. Cell culture supernatants from these cells and IgG from SLE patients (SLE IgG) were added to cultures of normal PBMCs or purified plasmacytoid dendritic cells (PDCs). The importance of nucleic acids for IFN alpha induction was investigated by RNase and DNase treatment. The IFN alpha levels were measured by immunoassay. RESULTS: Both necrotic and apoptotic U937 cells released material that, combined with SLE IgG, induced IFN alpha production in PDCs. The release from apoptotic cells occurred with a 16-hour delay, in late apoptosis. Also, normal PBMCs released IFN alpha-inducing material, but only during necrosis. The interferogenic activity of the necrotic material required the presence of RNA, while both RNA and DNA were important in the apoptotic material. In both cases, the presence of SLE IgG was necessary, and its activity correlated with the presence of antibodies to RNA-binding proteins, but not anti-DNA antibodies. CONCLUSION: Necrotic and late apoptotic cells release material that, combined with SLE IgG, induces production of IFN alpha in PDCs. The IFN alpha inducers probably consist of immune complexes (ICs) containing RNA and possibly DNA as essential interferogenic components. The presence of such interferogenic ICs could explain the ongoing production of IFN alpha in SLE and could be of etiopathogenic importance.
|
|
| 8. |
- Rönnblom, Lars, et al.
(författare)
-
Role of natural interferon-alpha producing cells (plasmacytoid dendritic cells) in autoimmunity
- 2003
-
Ingår i: Autoimmunity. - : Informa UK Limited. - 0891-6934 .- 1607-842X. ; 36:8, s. 463-72
-
Tidskriftsartikel (refereegranskat)abstract
- The type I interferons (IFNs) have antiviral, cytostatic and prominent immunomodulatory effects, which all are of great importance during viral infections. However, prolonged exposure of the immune system to type I IFN can break tolerance and initiate an autoimmune reaction, eventually leading to autoimmune disease. Recent observations in patients with systemic lupus erythematosus (SLE) have revealed that such individuals have endogenous IFN-alpha inducers, causing an ongoing IFN-alpha production and consequently a continuous stimulation of the immune system. These IFN-alpha inducers consist of small immune complexes (IC) containing DNA or RNA and act on the principal IFN-alpha producing cell, the natural IFN-alpha producing cell (NIPC), also termed the plasmacytoid dendritic cell (PDC). The NIPC/PDC is a key cell in both the innate and adaptive immune response but can also, either directly or via produced IFN-alpha, have a pivotal role in autoimmunity. In this review we summarize recent data concerning NIPC/PDC, including their activation, regulation, function and possible role in autoimmune diseases, especially SLE.
|
|
