1. |
|
|
2. |
- Ahlgren, Kerstin, M., et al.
(författare)
-
Type I Interferon signature in Nova Scotia duck tolling retriever dogs with steroid responsive meningitis-arteritis
-
Annan publikation (övrigt vetenskapligt/konstnärligt)abstract
- Objective: Dogs of the breed Nova Scotia duck tolling retriever (NSDTR) are prone to develop a disease complex in some aspects resembling human systemic lupus erythematosus (SLE). Peripheral blood mononuclear cells (PBMCs) from human SLE patients have an increased mRNA expression type I interferon (IFN) regulated genes. However, it is unknown whether diseased dogs also display the typical type I IFN signature. Methods: To test canine sera for their capacity to induce type I IFN response Mardin-Darby canine kidney (MDCK) cells were cultured with sera from healthy dogs (n=25), immune-mediated rheumatic disease (IMRD) dogs with anti-nuclear antibodies (ANA+) (n=30) or dogs with steroid responsive meningitis-arteritis (SRMA) (n=25). mRNA expression of the genes MX1, IFIT1 and CXCL10 was measured by quantitative Real Time PCR. Results: A highly significant (p=0.0009) increase in mRNA expression of the type I IFN responsive gene MX1 was detected in cells stimulated by sera from dogs with SRMA, but not from IMRD ANA+ dogs. Expression of IFIT1 was twice as high in cells stimulated by sera from dogs with SRMA compared to both healthy dogs and ANA+ dogs. The mean expression of CXCL10 was nearly ten times higher in cells stimulated by sera from SRMA dogs than by ANA+ dogs and four times higher compared to cells stimulated by control dogs. Conclusion: Presence of type I IFN in sera from diseased NSDTR dogs was found in this study. This implies that this canine model can be used for identification of pathways of importance for autoimmune disorders in humans and for testing of novel therapeutic approaches. Our results can also be a step on the way towards personalized drugs in these dogs.
|
|
3. |
- Almlöf, Jonas Carlsson, et al.
(författare)
-
Whole-genome sequencing identifies complex contributions to genetic risk by variants in genes causing monogenic systemic lupus erythematosus
- 2019
-
Ingår i: Human Genetics. - : SPRINGER. - 0340-6717 .- 1432-1203. ; 138:2, s. 141-150
-
Tidskriftsartikel (refereegranskat)abstract
- Systemic lupus erythematosus (SLE, OMIM 152700) is a systemic autoimmune disease with a complex etiology. The mode of inheritance of the genetic risk beyond familial SLE cases is currently unknown. Additionally, the contribution of heterozygous variants in genes known to cause monogenic SLE is not fully understood. Whole-genome sequencing of DNA samples from 71 Swedish patients with SLE and their healthy biological parents was performed to investigate the general genetic risk of SLE using known SLE GWAS risk loci identified using the ImmunoChip, variants in genes associated to monogenic SLE, and the mode of inheritance of SLE risk alleles in these families. A random forest model for predicting genetic risk for SLE showed that the SLE risk variants were mainly inherited from one of the parents. In the 71 patients, we detected a significant enrichment of ultra-rare (0.1%) missense and nonsense mutations in 22 genes known to cause monogenic forms of SLE. We identified one previously reported homozygous nonsense mutation in the C1QC (Complement C1q C Chain) gene, which explains the immunodeficiency and severe SLE phenotype of that patient. We also identified seven ultra-rare, coding heterozygous variants in five genes (C1S, DNASE1L3, DNASE1, IFIH1, and RNASEH2A) involved in monogenic SLE. Our findings indicate a complex contribution to the overall genetic risk of SLE by rare variants in genes associated with monogenic forms of SLE. The rare variants were inherited from the other parent than the one who passed on the more common risk variants leading to an increased genetic burden for SLE in the child. Higher frequency SLE risk variants are mostly passed from one of the parents to the offspring affected with SLE. In contrast, the other parent, in seven cases, contributed heterozygous rare variants in genes associated with monogenic forms of SLE, suggesting a larger impact of rare variants in SLE than hitherto reported.
|
|
4. |
- Balboni, Imelda, et al.
(författare)
-
Brief Report : Interferon-α Induction and Detection of Anti-Ro, Anti-La, Anti-Sm, and Anti-RNP Autoantibodies by Autoantigen Microarray Analysis in Juvenile Dermatomyositis
- 2013
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 65:9, s. 2424-2429
-
Tidskriftsartikel (refereegranskat)abstract
- Objective:To evaluate serum interferon- (IFN) activity in the context of autoantibody profiles in patients with juvenile dermatomyositis (JDM). Methods:Sera from 36 patients with JDM were analyzed. Autoantibody profiles were determined by probing microarrays, which were fabricated with approximate to 80 distinct autoantigens, with serum and a Cy3-conjugated secondary antibody. Arrays were scanned and analyzed to determine antigen reactivity. Serum IFN activity was measured using a functional reporter cell assay. Sera were assayed alone or in combination with cellular material released from necrotic U937 cells to stimulate peripheral blood mononuclear cells from healthy donors in vitro, and IFN production in culture was measured by a dissociation-enhanced lanthanide fluoroimmunoassay (DELFIA). Results:Reactivity against at least 1 of 41 autoantigens on the microarray, including Ro 52, Ro 60, La, Sm, and RNP, was observed in 75% of the serum samples from patients with JDM. IFN activity was detected in 7 samples by reporter cell assay. The reporter cell assay showed a significant association of reactivity against Ro, La, Sm, and proliferating cell nuclear antigen with serum IFN activity (P = 0.005). Significance Analysis of Microarrays (SAM) identified increased reactivity against Sm, RNP, Ro 52, U1-C, and Mi-2 in these sera. Sixteen samples induced IFN production as measured by DELFIA, and there was a significant association of reactivity against Ro, La, Sm, and RNP with the induction of IFN by serum and necrotic cell material (P = 0.034). SAM identified increased reactivity against Ro 60 in these sera. Conclusion:These data support the hypothesis that nucleic acid-associated autoantibodies, including the Ro/La and Sm/RNP complexes, may stimulate the production of active IFN in children with JDM.
|
|
5. |
|
|
6. |
|
|
7. |
- Berggren, Olof, et al.
(författare)
-
Activation of plasmacytoid dendritic cells and B cells with two structurally different Toll-like receptor 7 agonists
- 2020
-
Ingår i: Scandinavian Journal of Immunology. - : Wiley. - 0300-9475 .- 1365-3083. ; 91:6
-
Tidskriftsartikel (refereegranskat)abstract
- Synthetic Toll-like receptor (TLR) 7 agonists have been suggested as immune modulators in a range of conditions. In contrast, self-derived TLR7 activators, such as RNA-containing immune complexes (RNA-IC), can contribute to autoimmune diseases due to endogenous immune activation. The exact difference in immune cell response between synthetic and endogenous TLR7 triggers is only partly known. An understanding of these differences could aid in the development of new therapeutic agents and provide insights into autoimmune disease mechanisms. We therefore compared the stimulatory capacity of two TLR7 agonists, RNA-IC and a synthetic small molecule DSR-6434, on blood leucocytes, plasmacytoid dendritic cells (pDCs) and B cells from healthy individuals. IFN-α, IL-6, IL-8 and TNF levels were measured by immunoassays, and gene expression in pDCs was analysed by an expression array. DSR-6434 triggered 20-fold lower levels of IFN-α by pDCs, but higher production of IL-6, IL-8 and TNF, compared to RNA-IC. Furthermore, IFN-α and TNF production were increased with exogenous IFN-α2b priming, whereas IL-8 synthesis by B cells was reduced for both stimuli. Cocultivation of pDCs and B cells increased the RNA-IC-stimulated IFN-α and TNF levels, while only IL-6 production was enhanced in the DSR-6434-stimulated cocultures. When comparing pDCs stimulated with RNA-IC and DSR-6434, twelve genes were differentially expressed (log2 fold change >2, adjusted P-value <.05). In conclusion, RNA-IC, which mimics an endogenous TLR7 stimulator, and the synthetic TLR7 agonist DSR-6434 trigger distinct inflammatory profiles in immune cells. This demonstrates the importance of using relevant stimuli when targeting the TLR7 pathway for therapeutic purposes.
|
|
8. |
- Berggren, Olof, et al.
(författare)
-
B lymphocytes enhance the interferon-α production by plasmacytoid dendritic cells
- 2012
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 64:10, s. 3409-3419
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE:Type I interferon (IFN) system and B cells are activated in many autoimmune diseases, e.g. systemic lupus erythematosus (SLE). IFNα produced by plasmacytoid dendritic cells (pDC) stimulate several B cell functions, including autoantibody production. However, not much is known how B cells influence the pDC function. We therefore investigated the regulatory effect of B cells on IFNα production by pDC.METHODS:PDC and B cells from healthy blood donor PBMC were stimulated with RNA-containing immune complexes (RNA-IC) consisting of U1 snRNP and IgG from SLE patients, herpes simplex virus (HSV) or oligonucleotide ODN2216, alone or in co-cultures. IFNα, several other cytokines and pDC or B cell-associated surface molecules were analyzed by immunoassays or flow cytometry.RESULTS:B cells enhanced the IFNα production by pDC up to 47-fold, and the effect was most pronounced for pDC stimulated with RNA-IC. Anti-CD31 antibody reduced the RNA-IC-induced IFNα production by 80%, but not when ODN2216 was used as IFN-inducer. Supernatants from ODN2216-stimulated B cells promoted IFNα production by pDC, while supernatants from RNA-IC-stimulated B cells did not.CONCLUSION: Our results reveal a novel B cell function, enhancing the type I IFN production by pDC. Since B cells are activated by type I IFN, this pDC-B cell cross-talk might be of fundamental importance in the etiopathogenesis of SLE, and contribute to a chronic immune activation in SLE and other systemic rheumatic diseases.
|
|
9. |
|
|
10. |
- Berggren, Olof, et al.
(författare)
-
IFN-α production by plasmacytoid dendritic cell associations with polymorphisms in gene loci related to autoimmune and inflammatory diseases
- 2015
-
Ingår i: Human Molecular Genetics. - : Oxford University Press (OUP). - 0964-6906 .- 1460-2083. ; 24:12, s. 3571-3581
-
Tidskriftsartikel (refereegranskat)abstract
- The type I interferon (IFN) system is persistently activated in systemic lupus erythematosus (SLE) and many other systemic autoimmune diseases. Studies have shown an association between SLE and several gene variants within the type I IFN system. We investigated whether single nucleotide polymorphisms (SNPs) associated with SLE and other autoimmune diseases affect the IFN-α production in healthy individuals. Plasmacytoid dendritic cells (pDCs), B and NK cells were isolated from peripheral blood of healthy individuals and stimulated with RNA-containing immune complexes (IC), herpes simplex virus (HSV) or the oligonucleotide ODN2216. IFN-α production by pDCs alone or in cocultures with B or NK cells was measured by an immunoassay. All donors were genotyped with the 200K ImmunoChip and a 5bp CGGGG length polymorphism in the IFN regulatory factor 5 gene (IRF5) was genotyped by PCR. We found associations between IFN-α production and 18-86 SNPs (p ≤ 0.001), depending on the combination of the stimulated cell types. However, only three of these associated SNPs were shared between the cell type combinations. Several SNPs showed novel associations to the type I IFN system among all the associated SNPs, while some loci have been described earlier for their association with SLE. Furthermore, we found that the SLE-risk variant of the IRF5 CGGGG-indel was associated with lower IFN-α production. We conclude that the genetic variants affecting the IFN-α production highlight the intricate regulation of the type I IFN system and the importance of understanding the mechanisms behind the dysregulated type I IFN system in SLE.
|
|
11. |
- Berggren, Olof, et al.
(författare)
-
Plasmacytoid dendritic cells and RNA-containing immune complexes drive expansion of peripheral B cell subsets with an SLE-like phenotype
- 2017
-
Ingår i: PLOS ONE. - : PUBLIC LIBRARY SCIENCE. - 1932-6203. ; 12:8
-
Tidskriftsartikel (refereegranskat)abstract
- Background Hyperactive B cells and a continuous interferon (IFN)-alpha production by plasmacytoid dendritic cells (pDCs) play a key role in systemic lupus erythematosus (SLE). We asked whether the interaction between B cells and pDCs stimulated with RNA-containing immune complexes affects peripheral B cell subsets. Methods B cells and pDCs were isolated from blood of healthy individuals and stimulated with immune complexes consisting of SLE-IgG and U1snRNP (RNA-IC). Expression of cell surface molecules as well as IL-6 and IL-10 production were determined by flow cytometry and immunoassays. Gene expression profiles were determined by a NanoString nCounter expression array. Results We found a remarkable increase of double negative CD27-IgD-B cells, from 7% within fresh CD19+B cells to 37% in the RNA-IC-stimulated co-cultures of B cells and pDCs, comparable to the frequency of double negative B cells in SLE patients. Gene expression analysis of the double negative CD27-IgD -and the CD27 + IgD-memory B cells revealed that twenty-one genes were differentially expressed between the two B cell subsets (>= 2-fold, p< 0.001). The, IL21R, IL4R, CCL4, CCL3, CD83 and the IKAROS Family Zinc Finger 2 (IKZ2) showed higher expression in the double negative CD27-IgD-B cells. Conclusion The interactions between B cells and pDCs together with RNA-containing IC led to an expansion of B cells with similar phenotype as seen in SLE, suggesting that the pDC-B cell crosstalk contributes to the autoimmune feed-forward loop in SLE.
|
|
12. |
- Berggren, Olof
(författare)
-
Regulation of Type I Interferon Production in Plasmacytoid Dendritic Cells : Effect of Genetic Factors and Interactions with NK Cells and B Cells
- 2015
-
Doktorsavhandling (övrigt vetenskapligt/konstnärligt)abstract
- The type I interferon (IFN) system plays a central role in the etiopathogenesis of many autoimmune diseases, e.g. systemic lupus erythematosus (SLE). Activation of the type I IFN system in SLE is promoted by endogenous nucleic acid-containing immune complexes (ICs) which stimulate plasmacytoid dendritic cells (pDCs). This thesis focuses on the regulation of IFN-α production in pDCs, by interactions with B cells and natural killer (NK) cells, and by genetic factors.In Study I, RNA-IC-stimulated CD56dim NK cells were found to be activated via FcγRIIIa and enhanced the IFN-α production by pDCs. The enhancing effect of the NK cells was mediated via both soluble factors, such as the cytokine MIP-1β, and in a cell-cell contact mediated manner via the adhesion molecule LFA-1. In Study II, B cells enhanced the IFN-α production by pDCs via cell-cell contact or soluble factors, depending on the stimuli. The cell-cell contact-mediated enhancement, when the cells were stimulated with RNA-IC, was abolished by blocking the cell adhesion molecule CD31. B cells stimulated with the oligonucleotide ODN2216 enhanced the IFN-α production via soluble factors. In Study III, gene variants related to autoimmune or inflammatory diseases were analyzed for the association to the IFN-α production by pDCs, alone or in coculture with NK or B cells. Depending on cell combination, 18-86 SNPs (p < 0.001) were associated with the IFN-α production. Several of the SNPs showed novel associations to the type I IFN system, while some loci have been described earlier for their association with SLE, e.g. IL10 and PXK. In Study IV, several B cell populations were affected by cocultivation with pDCs and stimulation with RNA-IC. The frequency of CD24hiCD38hi B cells of regulatory character was increased in the pDC-B cell cocultures. However, RNA-IC-stimulation only induced modest levels of IL-10. A remarkably increased frequency of double negative CD27-IgD- B cells was found in the RNA-IC-stimulated cocultures of pDCs and B cells.In conclusion, the findings in the present thesis reveal novel mechanisms behind the regulation of the type I IFN system which could be important targets in autoimmune diseases with constantly activated pDCs.
|
|
13. |
|
|
14. |
|
|
15. |
- Blomberg, Stina, et al.
(författare)
-
Expression of the markers BDCA-2 and BDCA-4 and production of interferon-alpha by plasmacytoid dendritic cells in systemic lupus erythematosus
- 2003
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 48:9, s. 2524-32
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: To study the expression of blood dendritic cell antigen 2 (BDCA-2) and BDCA-4 molecules by plasmacytoid dendritic cells (PDCs) in the blood of patients with systemic lupus erythematosus (SLE), and to study PDC production of interferon-alpha (IFN alpha) and its inhibition by anti-BDCA-2 and anti-BDCA-4 antibodies. METHODS: Peripheral blood mononuclear cells (PBMCs) from SLE patients (SLE PBMCs) and from healthy controls were induced to produce IFN alpha in vitro by SLE serum containing an endogenous IFN alpha-inducing factor (SLE-IIF) or by herpes simplex virus type 1 (HSV-1). The frequencies and numbers of BDCA-2-, BDCA-3-, and BDCA-4-expressing cells were analyzed by flow cytometry, and the effects of anti-BDCA-2 and anti-BDCA-4 monoclonal antibodies (mAb) on IFN alpha production were investigated. RESULTS: IFN alpha production by SLE PBMCs induced by SLE-IIF or HSV-1 was decreased compared with that of healthy control PBMCs (P = 0.002 and P = 0.0007, respectively). The proportions of BDCA-2- and BDCA-3-expressing cells in SLE PBMCs were reduced compared with those in PBMCs from healthy controls (P = 0.01 and P = 0.004, respectively). IFN alpha producers in culture, especially among SLE PBMCs, displayed reduced BDCA-2 expression and constituted only a minority of the BDCA-2-positive cells, at least in healthy control PBMCs (median 18%). IFN alpha production by both SLE and healthy control PBMCs stimulated by SLE-IIF or HSV-1 was markedly reduced by anti-BDCA-2 mAb (median 81-98% inhibition). Anti-BDCA-4 mAb only partially inhibited SLE-IIF-induced IFN alpha production. CONCLUSION: SLE patients had a reduced number of BDCA-2-expressing PDCs, also termed natural IFN alpha-producing cells, and their IFN alpha production could be inhibited by anti-BDCA-2/4 mAb. Such mAb may be a therapeutic option for inhibiting the ongoing IFN alpha production in SLE patients.
|
|
16. |
- Blomberg, Stina, et al.
(författare)
-
Presence of cutaneous interferon-alpha producing cells in patients with systemic lupus erythematosus
- 2001
-
Ingår i: Lupus. - : SAGE Publications. - 0961-2033 .- 1477-0962. ; 10:7, s. 484-90
-
Tidskriftsartikel (refereegranskat)abstract
- Systemic lupus erythematosus (SLE) patients have increased levels of interferon-alfa (IFN-alpha) in the circulation but a reduced number of functionally intact natural IFN-alpha producing cells (IPC) in peripheral blood. In search for tissue localisation of activated IPC, we investigated skin biopsies from SLE patients for the occurrence of such cells. Eleven SLE patients with inflammatory skin lesions and six healthy controls were biopsied. An immunohistochemical technique (IH) and in situ hybridisation (ISH) were used to detect intracellular IFN-alpha protein and IFN-alpha mRNA, respectively. In all 11 biopsies from SLE lesions, a high number of IPC were detected by IH. In the nonlesional SLE biopsies we could also demonstrate IPC in 10/11 patients. In 6/11 SLE patients, IFN-alpha mRNA containing cells could be detected in the specimens. A low number of IPC were detected in 1/6 healthy controls by IH, but no ISH positive cells were seen. Our results demonstrate that SLE patients have active IPC in both dermal lesions and in noninflammatory skin. A recruitment of IPC from blood to peripheral tissues may explain the low number of circulating natural IPC in SLE patients. Because the type I IFN system is involved in the SLE disease process, these results are of interest for the understanding of the pathogenesis in SLE.
|
|
17. |
|
|
18. |
- Bolin, Karin, et al.
(författare)
-
Association of STAT4 Polymorphism with Severe Renal Insufficiency in Lupus Nephritis
- 2013
-
Ingår i: PLOS ONE. - : Public Library of Science. - 1932-6203. ; 8:12, s. 84450-
-
Tidskriftsartikel (refereegranskat)abstract
- Lupus nephritis is a cause of significant morbidity in systemic lupus erythematosus (SLE) and its genetic background has not been completely clarified. The aim of this investigation was to analyze single nucleotide polymorphisms (SNPs) for association with lupus nephritis, its severe form proliferative nephritis and renal outcome, in two Swedish cohorts. Cohort I (n = 567 SLE cases, n = 512 controls) was previously genotyped for 5676 SNPs and cohort II (n = 145 SLE cases, n = 619 controls) was genotyped for SNPs in STAT4, IRF5, TNIP1 and BLK. Case-control and case-only association analyses for patients with lupus nephritis, proliferative nephritis and severe renal insufficiency were performed. In the case-control analysis of cohort I, four highly linked SNPs in STAT4 were associated with lupus nephritis with genome wide significance with p = 3.7x10(-9), OR 2.20 for the best SNP rs11889341. Strong signals of association between IRF5 and an HLA-DR3 SNP marker were also detected in the lupus nephritis case versus healthy control analysis (pless than0.0001). An additional six genes showed an association with lupus nephritis with pless than0.001 (PMS2, TNIP1, CARD11, ITGAM, BLK and IRAK1). In the case-only meta-analysis of the two cohorts, the STAT4 SNP rs7582694 was associated with severe renal insufficiency with p = 1.6x10(-3) and OR 2.22. We conclude that genetic variations in STAT4 predispose to lupus nephritis and a worse outcome with severe renal insufficiency.
|
|
19. |
- Bremer, Hanna, et al.
(författare)
-
ILF2 and ILF3 are autoantigens in canine systemic autoimmune disease
- 2018
-
Ingår i: Scientific Reports. - : NATURE PUBLISHING GROUP. - 2045-2322. ; 8
-
Tidskriftsartikel (refereegranskat)abstract
- Dogs can spontaneously develop complex systemic autoimmune disorders, with similarities to human autoimmune disease. Autoantibodies directed at self-antigens are a key feature of these autoimmune diseases. Here we report the identification of interleukin enhancer-binding factors 2 and 3 (ILF2 and ILF3) as autoantigens in canine immune-mediated rheumatic disease. The ILF2 autoantibodies were discovered in a small, selected canine cohort through the use of human protein arrays; a method not previously described in dogs. Subsequently, ILF3 autoantibodies were also identified in the same cohort. The results were validated with an independent method in a larger cohort of dogs. ILF2 and ILF3 autoantibodies were found exclusively, and at a high frequency, in dogs that showed a speckled pattern of antinuclear antibodies on immunofluorescence. ILF2 and ILF3 autoantibodies were also found at low frequency in human patients with SLE and Sjogren's syndrome. These autoantibodies have the potential to be used as diagnostic biomarkers for canine, and possibly also human, autoimmune disease.
|
|
20. |
- Burska, Agata, et al.
(författare)
-
Type I interferon pathway assays in studies of rheumatic and musculoskeletal diseases : a systematic literature review informing EULAR points to consider
- 2023
-
Ingår i: RMD Open. - : BMJ Publishing Group Ltd. - 2056-5933. ; 9:1
-
Forskningsöversikt (refereegranskat)abstract
- ObjectivesTo systematically review the literature for assay methods that aim to evaluate type I interferon (IFN-I) pathway activation and to harmonise-related terminology.MethodsThree databases were searched for reports of IFN-I and rheumatic musculoskeletal diseases. Information about the performance metrics of assays measuring IFN-I and measures of truth were extracted and summarised. A EULAR task force panel assessed feasibility and developed consensus terminology.ResultsOf 10 037 abstracts, 276 fulfilled eligibility criteria for data extraction. Some reported more than one technique to measure IFN-I pathway activation. Hence, 276 papers generated data on 412 methods. IFN-I pathway activation was measured using: qPCR (n=121), immunoassays (n=101), microarray (n=69), reporter cell assay (n=38), DNA methylation (n=14), flow cytometry (n=14), cytopathic effect assay (n=11), RNA sequencing (n=9), plaque reduction assay (n=8), Nanostring (n=5), bisulphite sequencing (n=3). Principles of each assay are summarised for content validity. Concurrent validity (correlation with other IFN assays) was presented for n=150/412 assays. Reliability data were variable and provided for 13 assays. Gene expression and immunoassays were considered most feasible. Consensus terminology to define different aspects of IFN-I research and practice was produced.ConclusionsDiverse methods have been reported as IFN-I assays and these differ in what elements or aspects of IFN-I pathway activation they measure and how. No 'gold standard' represents the entirety of the IFN pathway, some may not be specific for IFN-I. Data on reliability or comparing assays were limited, and feasibility is a challenge for many assays. Consensus terminology should improve consistency of reporting.
|
|
21. |
- Båve, Ullvi, et al.
(författare)
-
Activation of the type I interferon system in primary Sjögren's syndrome : a possible etiopathogenic mechanism
- 2005
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 52:4, s. 1185-1195
-
Tidskriftsartikel (refereegranskat)abstract
- Objective The etiopathogenesis of primary Sjögren's syndrome (SS) is largely unknown. In other autoimmune diseases, type I interferon (IFN) may play a pivotal role by triggering and sustaining the disease process. We therefore aimed to determine whether patients with primary SS had an activated type I IFN system. Methods Salivary gland biopsy specimens and sera from patients with primary SS were investigated for the occurrence of IFNα-producing cells and measurable IFNα levels, respectively. The ability of primary SS sera together with apoptotic or necrotic cells to induce IFNα production in normal peripheral blood mononuclear cells was examined. The IFNα inducer was characterized, and IFNα-producing cells were identified. Clinical data were correlated with the IFNα-inducing capacity of primary SS sera. Results Numerous IFNα-producing cells were detected in salivary gland biopsy specimens, despite low serum IFNα levels. Autoantibodies to RNA-binding proteins, combined with material released by necrotic or late apoptotic cells, were potent inducers of IFNα production in plasmacytoid dendritic cells (PDCs). This appeared to be attributable to RNA-containing immune complexes triggering PDCs by means of RNA and interaction with Fcγ receptor IIa. The IFNα-inducing capacity of sera was associated with positive results of a labial salivary gland biopsy (focus score ≥1) and with dermatologic, hematologic, and pulmonary manifestations. Conclusion Patients with primary SS have an activated type I IFN system. Although virus may initiate the production of IFN, the continued IFNα synthesis is caused by RNA-containing immune complexes that activate PDCs to prolong IFNα production at the tissue level. This IFNα promotes the autoimmune process by a vicious circle–like mechanism, with increased autoantibody production and formation of more endogenous IFNα inducers.
|
|
22. |
|
|
23. |
- Båve, Ullvi, et al.
(författare)
-
Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG
- 2003
-
Ingår i: Journal of Immunology. - : American Association of Immunologists. - 0022-1767 .- 1550-6606. ; 171:6, s. 3296-302
-
Tidskriftsartikel (refereegranskat)abstract
- An ongoing production of IFN-alpha may be of etiopathogenic significance in systemic lupus erythematosus (SLE). It may be due to the natural IFN-producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), activated by immune complexes that contain nucleic acids derived from apoptotic cells. We here examined the role of FcgammaR in the IFN-alpha production in vitro by PBMC induced by the combination of apoptotic U937 cells and autoantibody-containing IgG from SLE patients (SLE-IgG). The Fc portion of the SLE-IgG was essential to induce IFN-alpha production, because Fab fragments or F(ab')(2) were ineffective. Normal, especially heat-aggregated, IgG inhibited the IFN-alpha production, suggesting a role for FcgammaR on PBMC. Using blocking anti-FcgammaR Abs, the FcgammaRIIa,c (CD32) but not FcgammaRI or FcgammaRIII were shown to be involved in the IFN-alpha induction by apoptotic cells combined with SLE-IgG, but not by HSV or CpG DNA. In contrast, the action of all of these inducers was inhibited by the anti-FcgammaRIIa,b,c mAb AT10 or heat-aggregated IgG. Flow cytometric analysis revealed that approximately 50% of the BDCA-2-positive PBMC, i.e., NIPC/PDC, expressed low but significant levels of FcgammaRII, as did most of the actual IFN-alpha producers activated by HSV. RT-PCR applied to NIPC/PDC purified by FACS demonstrated expression of FcgammaRIIa, but not of FcgammaRIIb or FcgammaRIIc. We conclude that FcgammaRIIa on NIPC/PDC is involved in the activation of IFN-alpha production by interferogenic immune complexes, but may also mediate inhibitory signals. The FcgammaRIIa could therefore have a key function in NIPC/PDC and be a potential therapeutic target in SLE.
|
|
24. |
|
|
25. |
- Carlsson Almlöf, Jonas, et al.
(författare)
-
Contributions of de novo variants to systemic lupus erythematosus
- 2021
-
Ingår i: European Journal of Human Genetics. - : Springer Nature. - 1018-4813 .- 1476-5438. ; 29:1, s. 184-193
-
Tidskriftsartikel (refereegranskat)abstract
- By performing whole-genome sequencing in a Swedish cohort of 71 parent-offspring trios, in which the child in each family is affected by systemic lupus erythematosus (SLE, OMIM 152700), we investigated the contribution of de novo variants to risk of SLE. We found de novo single nucleotide variants (SNVs) to be significantly enriched in gene promoters in SLE patients compared with healthy controls at a level corresponding to 26 de novo promoter SNVs more in each patient than expected. We identified 12 de novo SNVs in promoter regions of genes that have been previously implicated in SLE, or that have functions that could be of relevance to SLE. Furthermore, we detected three missense de novo SNVs, five de novo insertion-deletions, and three de novo structural variants with potential to affect the expression of genes that are relevant for SLE. Based on enrichment analysis, disease-affecting de novo SNVs are expected to occur in one-third of SLE patients. This study shows that de novo variants in promoters commonly contribute to the genetic risk of SLE. The fact that de novo SNVs in SLE were enriched to promoter regions highlights the importance of using whole-genome sequencing for identification of de novo variants.
|
|
26. |
- Carlsson Almlöf, Jonas, et al.
(författare)
-
Novel risk genes for systemic lupus erythematosus predicted by random forest classification
- 2017
-
Ingår i: Scientific Reports. - : Springer Science and Business Media LLC. - 2045-2322. ; 7:1
-
Tidskriftsartikel (refereegranskat)abstract
- Genome-wide association studies have identified risk loci for SLE, but a large proportion of the genetic contribution to SLE still remains unexplained. To detect novel risk genes, and to predict an individual's SLE risk we designed a random forest classifier using SNP genotype data generated on the "Immunochip" from 1,160 patients with SLE and 2,711 controls. Using gene importance scores defined by the random forest classifier, we identified 15 potential novel risk genes for SLE. Of them 12 are associated with other autoimmune diseases than SLE, whereas three genes (ZNF804A, CDK1, and MANF) have not previously been associated with autoimmunity. Random forest classification also allowed prediction of patients at risk for lupus nephritis with an area under the curve of 0.94. By allele-specific gene expression analysis we detected cis-regulatory SNPs that affect the expression levels of six of the top 40 genes designed by the random forest analysis, indicating a regulatory role for the identified risk variants. The 40 top genes from the prediction were overrepresented for differential expression in B and T cells according to RNA-sequencing of samples from five healthy donors, with more frequent over-expression in B cells compared to T cells.
|
|
27. |
- Cavalli, Marco, et al.
(författare)
-
Allele-specific transcription factor binding to common and rare variants associated with disease and gene expression
- 2016
-
Ingår i: Human Genetics. - : Springer Science and Business Media LLC. - 0340-6717 .- 1432-1203. ; 135:5, s. 485-497
-
Tidskriftsartikel (refereegranskat)abstract
- Genome-wide association studies (GWAS) have identified a large number of disease-associated SNPs, but in few cases the functional variant and the gene it controls have been identified. To systematically identify candidate regulatory variants, we sequenced ENCODE cell lines and used public ChIP-seq data to look for transcription factors binding preferentially to one allele. We found 9962 candidate regulatory SNPs, of which 16 % were rare and showed evidence of larger functional effect than common ones. Functionally rare variants may explain divergent GWAS results between populations and are candidates for a partial explanation of the missing heritability. The majority of allele-specific variants (96 %) were specific to a cell type. Furthermore, by examining GWAS loci we found >400 allele-specific candidate SNPs, 141 of which were highly relevant in our cell types. Functionally validated SNPs support identification of an SNP in SYNGR1 which may expose to the risk of rheumatoid arthritis and primary biliary cirrhosis, as well as an SNP in the last intron of COG6 exposing to the risk of psoriasis. We propose that by repeating the ChIP-seq experiments of 20 selected transcription factors in three to ten people, the most common polymorphisms can be interrogated for allele-specific binding. Our strategy may help to remove the current bottleneck in functional annotation of the genome.
|
|
28. |
- Dahlqvist, Johanna, 1979-, et al.
(författare)
-
Identification and functional characterization of a novel susceptibility locus for small vessel vasculitis with MPO-ANCA
- 2022
-
Ingår i: Rheumatology. - Oxford, United Kingdom : Oxford University Press (OUP). - 1462-0324 .- 1462-0332. ; 61:8, s. 3461-3470
-
Tidskriftsartikel (refereegranskat)abstract
- Objective To identify and characterize genetic loci associated with the risk of developing ANCA-associated vasculitides (AAV). Methods Genetic association analyses were performed after Illumina sequencing of 1853 genes and subsequent replication with genotyping of selected single nucleotide polymorphisms in a total cohort of 1110 Scandinavian cases with granulomatosis with polyangiitis or microscopic polyangiitis, and 1589 controls. A novel AAV-associated single nucleotide polymorphism was analysed for allele-specific effects on gene expression using luciferase reporter assay. Results PR3-ANCA(+) AAV was significantly associated with two independent loci in the HLA-DPB1/HLA-DPA1 region [rs1042335, P = 6.3 x 10(-61), odds ratio (OR) 0.10; rs9277341, P = 1.5 x 10(-44), OR 0.22] and with rs28929474 in the SERPINA1 gene (P = 2.7 x 10(-10), OR 2.9). MPO-ANCA(+) AAV was significantly associated with the HLA-DQB1/HLA-DQA2 locus (rs9274619, P = 5.4 x 10(-25), OR 3.7) and with a rare variant in the BACH2 gene (rs78275221, P = 7.9 x 10(-7), OR 3.0), the latter a novel susceptibility locus for MPO-ANCA(+) granulomatosis with polyangiitis/microscopic polyangiitis. The rs78275221-A risk allele reduced luciferase gene expression in endothelial cells, specifically, as compared with the non-risk allele. Conclusion We identified a novel susceptibility locus for MPO-ANCA(+) AAV and propose that the associated variant is of mechanistic importance, exerting a regulatory function on gene expression in specific cell types.
|
|
29. |
|
|
30. |
|
|
31. |
- Domeika, Kristina, et al.
(författare)
-
Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
- 2004
-
Ingår i: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102
-
Tidskriftsartikel (refereegranskat)abstract
- The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
|
|
32. |
- Eloranta, Maija-Leena, et al.
(författare)
-
A possible mechanism for endogenous activation of the type I interferon system in myositis patients with anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies
- 2007
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 56:9, s. 3112-3124
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: To investigate type I interferon (IFN) system activation and its correlation with autoantibodies and organ manifestations in polymyositis (PM), dermatomyositis (DM), and inclusion body myositis. METHODS: Sera from 30 patients and 16 healthy controls, or purified IgG, were combined with material released from necrotized cells to stimulate IFNalpha production by peripheral blood mononuclear cells (PBMCs) from healthy blood donors. Muscle biopsy specimens from 25 patients and 7 healthy controls were investigated for blood dendritic cell antigen 2 (BDCA-2)-positive plasmacytoid dendritic cells (PDCs) and IFNalpha/beta-inducible myxovirus resistance 1 (MX-1) protein. RESULTS: Sera from 13 patients who were positive for anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies induced IFNalpha production in PBMCs when combined with necrotic cell material. In addition, IgG prepared from anti-Jo-1-positive PM sera induced IFNalpha with necrotic material, but not when the latter was treated with RNase. BDCA-2 expression in PDCs in muscle tissue was increased in PM patients with anti-Jo-1 autoantibodies, while MX-1 staining in capillaries was increased in DM patients, compared with healthy individuals. IFNalpha-inducing capacity correlated with interstitial lung disease, while MX-1 expression in the capillaries correlated with DM. CONCLUSION: Immune complexes containing anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies and RNA may act as endogenous IFNalpha inducers that activate IFNalpha production in PDCs. These PDCs could be of importance for inducing myositis, whereas in DM patients without autoantibodies the presence of MX-1 protein in capillaries suggests another cellular IFNalpha source and induction mechanism. Consequently, the type I IFN system may be of importance in both PM and DM, but via different pathways.
|
|
33. |
- Eloranta, Maija-Leena, et al.
(författare)
-
Cause and consequences of the activated type I interferon system in SLE
- 2016
-
Ingår i: Journal of Molecular Medicine. - : Springer Science and Business Media LLC. - 0946-2716 .- 1432-1440. ; 94:10, s. 1103-1110
-
Tidskriftsartikel (refereegranskat)abstract
- Patients with systemic lupus erythematosus (SLE) have an increased expression of type I interferon (IFN)-regulated genes (an IFN signature), which is caused by an ongoing production of type I IFNs by plasmacytoid dendritic cells (pDCs). The reasons behind the continuous IFN production in SLE are the presence of self-derived IFN inducers and a lack of negative feed-back signals that downregulate the IFN response. In addition, several cells in the immune system promote the IFN production by pDCs and gene variants in the type I IFN signaling pathway contribute to the IFN signature. The type I IFNs act as an immune adjuvant and stimulate T cells, B cells, and monocytes, which all play an important role in the loss of tolerance and persistent autoimmune reaction in SLE. Consequently, new treatments aiming to inhibit the activated type I IFN system in SLE are now being developed and investigated in clinical trials.
|
|
34. |
|
|
35. |
|
|
36. |
- Eloranta, Maija-Leena, et al.
(författare)
-
Regulation of the interferon-alpha production induced by RNA-containing immune complexes in plasmacytoid dendritic cells
- 2009
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 60:8, s. 2418-2427
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: Interferon-alpha (IFNalpha) is produced in several autoimmune diseases, including systemic lupus erythematosus (SLE), and may be important in their pathogenesis. We undertook this study to investigate how IFNalpha production induced by RNA-containing immune complexes (ICs) in plasmacytoid dendritic cells (PDCs) is regulated. METHODS: Normal PDCs purified from peripheral blood mononuclear cells (PBMCs) were cocultivated with other cell populations isolated from healthy individuals or SLE patients. IFNalpha production was induced by RNA-containing ICs, which consisted of anti-RNP autoantibodies and U1 small nuclear RNP particles, and the effects of prostaglandin E2 (PGE2), reactive oxygen species (ROS), or the cytokines IFNalpha2b, granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-10 (IL-10), or tumor necrosis factor alpha (TNFalpha) were explored. RESULTS: Monocytes inhibited IFNalpha production by PDCs in PBMC cultures, while natural killer (NK) cells were stimulatory. The monocytes had little effect on IFNalpha production by pure PDCs but inhibited its stimulation by NK cells. Monocytes from SLE patients were less inhibitory. Exposure of PBMCs or PDCs to IFNalpha2b/GM-CSF increased their IFNalpha production. RNA-containing ICs caused production of ROS, PGE2, and TNFalpha, especially in monocytes. These mediators and IL-10 suppressed IFNalpha production in PBMC cultures, with ROS and PGE2 also inhibiting IFNalpha production by purified PDCs. Inhibition by all of these agents, except for ROS, was abolished by IFNalpha2b/GM-CSF. The inhibitory effect of monocytes was significantly counteracted by the ROS scavengers serotonin and catalase. CONCLUSION: IFNalpha production induced by RNA-containing ICs in PDCs is regulated by a network of interactions between monocytes, NK cells, and PDCs, involving several pro- and antiinflammatory molecules. This should be considered when designing and applying new therapies.
|
|
37. |
- Eloranta, Maija-Leena, et al.
(författare)
-
Type I interferon system activation and association with disease manifestations in systemic sclerosis
- 2010
-
Ingår i: Annals of the Rheumatic Diseases. - : BMJ. - 0003-4967 .- 1468-2060. ; 69:7, s. 1396-1402
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVES: To study the presence of interferogenic autoantibodies in systemic sclerosis (SSc) and their correlation with clinical manifestations, serum levels of interferon alpha (IFNalpha) and chemokines of importance in the disease process. METHODS: Peripheral blood mononuclear cells (PBMCs) or purified plasmacytoid dendritic cells (pDCs) from healthy donors were stimulated with sera from patients with SSc (n=70) or healthy individuals (n=30), together with necrotic or apoptotic cell material. The IFNalpha produced and serum levels of IFNalpha, IFN-inducible protein-10 (IP-10)/chemokine (C-X-C motif) ligand 10, monocyte chemoattractant protein-1 (MCP-1)/(C-C motif) ligand-2 (CCL-2), macrophage inflammatory protein-1alpha (MIP-1alpha)/CCL-3 and RANTES/CCL-5 were measured and correlated with the presence of autoantibodies and clinical manifestations in the patients with SSc. RESULTS: Sera from both diffuse SSc and limited SSc contained interferogenic antibodies, which correlated with the presence of anti-ribonucleoprotein and anti-Sjögren syndrome antigen autoantibodies. The pDCs were responsible for the IFNalpha production which required interaction with FcgammaRII and endocytosis. Increased serum levels of IP-10 were associated with vascular manifestations such as cardiac involvement (p=0.027) and pulmonary arterial hypertension (p=0.036). Increased MCP-1 or IFNalpha serum levels were associated with lung fibrosis (p=0.019 and 0.048, respectively). Digital ulcers including digital loss were associated with increased serum levels of IFNalpha (p=0.029). CONCLUSION: An activated type I IFN system previously seen in several other systemic autoimmune diseases is also present in SSc and may contribute to the vascular pathology and affect the profibrotic process.
|
|
38. |
- Emilsson, Össur Ingi, et al.
(författare)
-
Different chest HRCT scan protocols change the extent of ground glass opacities
- 2022
-
Ingår i: BMC Pulmonary Medicine. - : BioMed Central (BMC). - 1471-2466. ; 22:1
-
Tidskriftsartikel (refereegranskat)abstract
- BackgroundGround glass opacity (GGO) is the main HRCT feature representing alveolitis in systemic sclerosis-associated interstitial lung disease (SSc-ILD), but may also represent other conditions such as atelectasis or edema. It is unclear how much this is affected by the HRCT scan protocol used. We aimed to compare the performance of three different HRCT protocols to evaluate the degree of SSc-ILD related changes.MethodsEleven patients with SSc underwent chest HRCT scan by three different protocols: First, a supine scan after lying down for 15 minutes, then two scans in alternating order: A prone position scan, and a supine position scan after performing 10 deep breaths using a positive expiratory pressure (PEP) device. The HRCT scans were evaluated by the Warrick score system for ILD-related findings.ResultsThe three HRCT protocols were compared and resulted in different mean (95% CI) Warrick scores: 9.4 (5.3–13.4) in supine after rest; 7.5 (95% CI 3.8–11.1) in prone and 7.6 (95% CI 4.2–11.1) in supine after PEP. When comparing supine after rest to prone and supine after PEP, the latter two scans had a significantly lower score (p = 0.001 for both comparisons). In all cases, only sub-scores for ground glass opacities differed, while sub-scores for fibrosis-related changes did not change.ConclusionsDifferent HRCT scan protocols significantly altered the Warrick severity score for SSc-ILD findings, primarily because of changes in ground glass opacities. These differences may be clinically meaningful.
|
|
39. |
- Enocsson, Helena, et al.
(författare)
-
Association of Serum C-Reactive Protein Levels With Lupus Disease Activity in the Absence of Measurable Interferon-α and a C-Reactive Protein Gene Variant
- 2014
-
Ingår i: Arthritis & rheumatology (Hoboken, N.J.). - Hoboken, NJ, United States : John Wiley & Sons. - 2326-5191 .- 2326-5205. ; 66:6, s. 1568-1573
-
Tidskriftsartikel (refereegranskat)abstract
- Objectives: The type I interferon (IFN) system is important in the pathogenesis of systemic lupus erythematosus (SLE). We previously demonstrated an inhibitory effect of IFNα on interleukin 6 (IL-6) induced C-reactive protein (CRP) in vitro, hypothetically explaining the poor correlation between disease activity and CRP levels in SLE. Herein we investigated disease activity, IL-6 and CRP in relation to a CRP gene polymorphism and IFN.Methods: Sera from 155 SLE patients and 100 controls were analyzed for CRP. Patients were genotyped for a CRP single nucleotide polymorphism (rs1205) associated with low CRP levels. Serum IFNα and IL-6 was quantified by immunoassays. Clinical disease activity was assessed by SLE disease activity index 2000 (SLEDAI-2K).Results: CRP levels were increased in SLE patients compared to controls, but were not associated with SLEDAI-2K or IL-6 levels. However, exclusion of patients carrying at least one rs1205 minor allele revealed an association between disease activity and CRP levels (p=0.005). We found a strong association between disease activity and CRP levels (p<0.0005) when patients with measurable IFNα as well as the minor allele of rs1205 where excluded from the analysis. Similarly, when patients with raised IFNα and/or the rs1205 polymorphism were excluded, IL-6 associated with CRP levels.Conclusions: The present study demonstrates that serum IFNα as well as CRP genotype affects the CRP response in SLE patients. Lack of correlation between serum levels of CRP and disease activity could therefore be explained by activation of the type I IFN system and polymorphisms in the CRP gene. © 2014 American College of Rheumatology.
|
|
40. |
- Enocsson, Helena, et al.
(författare)
-
C-Reactive Protein Levels in Systemic Lupus Erythematosus Are Modulated by the Interferon Gene Signature and CRP Gene Polymorphism rs1205
- 2021
-
Ingår i: Frontiers in Immunology. - : Frontiers Media SA. - 1664-3224. ; 11
-
Tidskriftsartikel (refereegranskat)abstract
- Objectives: Patients with systemic lupus erythematosus (SLE) often display modest elevations of C-reactive protein (CRP) despite raised disease activity and increased interleukin (IL-) 6. We asked to what extent IL-6 levels, the CRP polymorphism rs1205, and the type I interferon (IFN) gene signature affects the basal CRP levels in patients with SLE during a quiescent phase of the disease. Methods: CRP and IL-6 were analyzed in plasma from 57 patients meeting established classification criteria for SLE. The CRP polymorphism rs1205 was assessed and gene expression analyzed including four type I IFN-regulated genes (IGS). Results: CRP was increased in patients with detectable IL-6 levels (p=0.001) and decreased among IGS-positive subjects (p=0.033). A multiple linear regression model revealed IL-6 to have a positive association with CRP levels, whereas both IGS-positivity and CRP genotype (rs1205) AA/GA were negatively associated with CRP-levels. Conclusion: Our data offer an explanation to the modest CRP levels seen in viral infections and IFN-α driven autoimmunity and corroborate prior observations showing an IFN-α dependent downregulation of CRP. The latter observation, together with the fact that the CRP-lowering polymorphism rs1205 is overrepresented in human SLE, could explain low basal CRP and inadequate CRP-responses among patients with active SLE.
|
|
41. |
- Enocsson, Helena, et al.
(författare)
-
Comparison of Surrogate Markers of the Type I Interferon Response and Their Ability to Mirror Disease Activity in Systemic Lupus Erythematosus
- 2021
-
Ingår i: Frontiers in Immunology. - : Frontiers Media S.A.. - 1664-3224. ; 12
-
Tidskriftsartikel (refereegranskat)abstract
- Objectives: Type I interferons (IFNs) are central and reflective of disease activity in systemic lupus erythematosus (SLE). However, IFN-alpha levels are notoriously difficult to measure and the type I IFN gene signature (IGS) is not yet available in clinical routine. This study evaluates galectin-9 and an array of chemokines/cytokines in their potential as surrogate markers of type I IFN and/or SLE disease activity.Methods: Healthy controls and well-characterized Swedish SLE patients from two cross-sectional cohorts (n=181; n=59) were included, and a subgroup (n=21) was longitudinally followed. Chemokine/cytokine responses in immune complex triggered IFN-alpha activity was studied in healthy donor peripheral blood mononuclear cells (PBMC). Levels of chemokines/cytokines and galectin-9 were measured by immunoassays. Gene expression was quantified by qPCR.Results: The IGS was significantly (p<0.01) correlated with galectin-9 (rho=0.54) and CXCL10 (rho=0.37) levels whereas serum IFN-alpha correlated with galectin-9 (rho=0.36), CXCL10 (rho=0.39), CCL19 (rho=0.26) and CCL2 (rho=0.19). The strongest correlation was observed between galectin-9 and TNF (rho=0.56). IFN-alpha and disease activity (SLEDAI-2K) were correlated (rho=0.20) at cross-sectional analysis, but no significant associations were found between SLEDAI-2K and galectin-9 or chemokines. Several inflammatory mediators increased at disease exacerbation although CCL19, CXCL11, CXCL10, IL-10 and IL-1 receptor antagonist were most pronounced. Immune complex-stimulation of PBMC increased the production of CCL2, CXCL8 and TNF.Conclusion: Galectin-9 and CXCL10 were associated with type I IFN in SLE but correlated stronger with TNF. None of the investigated biomarkers showed a convincing association with disease activity, although CXCL10 and CCL19 performed best in this regard.
|
|
42. |
- Enocsson, Helena, et al.
(författare)
-
Interferon-alpha Mediates Suppression of C-Reactive Protein Explanation for Muted C-Reactive Protein Response in Lupus Flares?
- 2009
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 60:12, s. 3755-3760
-
Tidskriftsartikel (refereegranskat)abstract
- Objective. C-reactive protein (CRP) is synthesized by hepatocytes in response to interleukin-6 (IL-6) during inflammation. Despite raised IL-6 levels and extensive systemic inflammation, serum CRP levels remain low during most viral infections and disease flares of systemic lupus erythematosus (SLE). Because both viral infections and SLE are characterized by high levels of interferon-alpha (IFN alpha), the aim of this study was to determine whether this cytokine can inhibit the induction of CRP. Methods. The interference of all 12 IFN alpha subtypes with CRP promoter activity induced by IL-6 and IL-1 beta was studied in a CRP promoter- and luciferase reporter-transfected human hepatoma cell line, Hep-G2. CRIP secretion by primary human hepatocytes was analyzed by enzyme-linked immunosorbent assay. Results. CRP promoter activity was inhibited by all single IFN alpha subtypes, as well as by 2 different mixtures of biologically relevant IFN alpha subtypes. The most prominent effect was seen using a leukocyte-produced mixture of IFN alpha (56% inhibition at 1,000 IU/ml). The inhibitory effect of IFN alpha was confirmed in primary human hepatocytes. CRP promoter inhibition was dose dependent and mediated via the type I IFN receptor. Transferrin production and Hep-G2 proliferation/viability were not affected by IFN alpha. Conclusion. The current study demonstrates that IFN alpha is an inhibitor of CRP promoter activity and CRP secretion. This finding concords with previous observations of up-regulated IFN alpha and a muted CRP response during SLE disease flares. Given the fundamental role of both IFN alpha and CRP in the immune response, our results are of importance for understanding the pathogenesis of SLE and may also contribute to understanding the differences in the CRP response between viral and bacterial infections.
|
|
43. |
- Enocsson, Helena, et al.
(författare)
-
Serum C-reactive protein (CRP) associates with lupus disease activity in the absence of measurable interferon alpha and a CRP gene variant
- 2014
-
Ingår i: Arthritis & rheumatology. - : Wiley. - 2326-5205 .- 2326-5191. ; 66:6, s. 1568-1573
-
Tidskriftsartikel (refereegranskat)abstract
- Objectives: The type I interferon (IFN) system is important in the pathogenesis of systemic lupus erythematosus (SLE). We previously demonstrated an inhibitory effect of IFNα on interleukin 6 (IL-6) induced C-reactive protein (CRP) in vitro, hypothetically explaining the poor correlation between disease activity and CRP levels in SLE. Herein we investigated disease activity, IL-6 and CRP in relation to a CRP gene polymorphism and IFNαMethods: Sera from 155 SLE patients and 100 controls were analyzed for CRP. Patients were genotyped for a CRP single nucleotide polymorphism (rs1205) associated with low CRP levels. Serum IFNα and IL-6 was quantified by immunoassays. Clinical disease activity was assessed by SLE disease activity index 2000 (SLEDAI-2K).Results: CRP levels were increased in SLE patients compared to controls, but were not associated with SLEDAI-2K or IL-6 levels. However, exclusion of patients carrying at least one rs1205 minor allele revealed an association between disease activity and CRP levels (p=0.005). We found a strong association between disease activity and CRP levels (p<0.0005) when patients with measurable IFNα as well as the minor allele of rs1205 where excluded from the analysis. Similarly, when patients with raised IFNα and/or the rs1205 polymorphism were excluded, IL-6 associated with CRP levels.Conclusions: The present study demonstrates that serum IFNα as well as CRP genotype affects the CRP response in SLE patients. Lack of correlation between serum levels of CRP and disease activity could therefore be explained by activation of the type I IFN system and polymorphisms in the CRP gene.
|
|
44. |
- Espinosa, Alexander, et al.
(författare)
-
Loss of the lupus autoantigen Ro52/Trim21 induces tissue inflammation and systemic autoimmunity by disregulating the IL-23-Th17 pathway
- 2009
-
Ingår i: Journal of Experimental Medicine. - : Rockefeller University Press. - 0022-1007 .- 1540-9538. ; 206:8, s. 1661-1671
-
Tidskriftsartikel (refereegranskat)abstract
- Ro52/Trim21 is targeted as an autoantigen in systemic lupus erythematosus and Sjögren's syndrome. Polymorphisms in the Ro52 gene have been linked to these autoimmune conditions, but the molecular mechanism by which Ro52 may promote development of systemic autoimmune diseases has not been explored. To address this issue, we generated Ro52-null mice (Ro52(-/-)), which appear phenotypically normal if left unmanipulated. However, Ro52(-/-) mice develop severe dermatitis extending from the site of tissue injury induced by ear tags. The affected mice further develop several signs of systemic lupus with hypergammaglobulinemia, autoantibodies to DNA, proteinuria, and kidney pathology. Ro52, which was recently identified as an E3 ligase, mediates ubiquitination of several members of the interferon regulatory factor (IRF) family, and the Ro52-deficient mice have an enhanced production of proinflammatory cytokines that are regulated by the IRF transcription factors, including cytokines involved in the Th17 pathway (interleukin [IL] 6, IL-12/IL-23p40, and IL-17). Loss of IL-23/IL-17 by genetic deletion of IL-23/p19 in the Ro52(-/-) mice conferred protection from skin disease and systemic autoimmunity. These data reveal that the lupus-associated Ro52 protein is an important negative regulator of proinflammatory cytokine production, and they provide a mechanism by which a defective Ro52 function can lead to tissue inflammation and systemic autoimmunity through the IL-23-Th17 pathway.
|
|
45. |
- Farias, Fabiana H. G., et al.
(författare)
-
A rare regulatory variant in the MEF2D gene affects gene regulation and splicing and is associated with a SLE sub-phenotype in Swedish cohorts
- 2019
-
Ingår i: European Journal of Human Genetics. - : Springer Science and Business Media LLC. - 1018-4813 .- 1476-5438. ; 27, s. 432-441
-
Tidskriftsartikel (refereegranskat)abstract
- Systemic lupus erythematosus (SLE) is an autoimmune disorder with heterogeneous clinical presentation and complex etiology involving the interplay between genetic, epigenetic, environmental and hormonal factors. Many common SNPs identified by genome wide-association studies (GWAS) explain only a small part of the disease heritability suggesting the contribution from rare genetic variants, undetectable in GWAS, and complex epistatic interactions. Using targeted re-sequencing of coding and conserved regulatory regions within and around 215 candidate genes selected on the basis of their known role in autoimmunity and genes associated with canine immune-mediated diseases, we identified a rare regulatory variant rs200395694:G > T located in intron 4 of the MEF2D gene encoding the myocyte-specific enhancer factor 2D transcription factor and associated with SLE in Swedish cohorts (504 SLE patients and 839 healthy controls, p = 0.014, CI = 1.1-10). Fisher's exact test revealed an association between the genetic variant and a triad of disease manifestations including Raynaud, anti-U1-ribonucleoprotein (anti-RNP), and anti-Smith (anti-Sm) antibodies (p = 0.00037) among the patients. The DNA-binding activity of the allele was further studied by EMSA, reporter assays, and minigenes. The region has properties of an active cell-specific enhancer, differentially affected by the alleles of rs200395694:G > T. In addition, the risk allele exerts an inhibitory effect on the splicing of the alternative tissue-specific isoform, and thus may modify the target gene set regulated by this isoform. These findings emphasize the potential of dissecting traits of complex diseases and correlating them with rare risk alleles with strong biological effects.
|
|
46. |
|
|
47. |
- Feng, Di, et al.
(författare)
-
Genetic variants and disease-associated factors contribute to enhanced interferon regulatory factor 5 expression in blood cells of patients with systemic lupus erythematosus
- 2010
-
Ingår i: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 62:2, s. 562-573
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: Genetic variants of the interferon (IFN) regulatory factor 5 gene (IRF5) are associated with susceptibility to systemic lupus erythematosus (SLE). The contribution of these variants to IRF-5 expression in primary blood cells of SLE patients has not been addressed, nor has the role of type I IFNs. The aim of this study was to determine the association between increased IRF-5 expression and the IRF5 risk haplotype in SLE patients. METHODS: IRF-5 transcript and protein levels in 44 Swedish patients with SLE and 16 healthy controls were measured by quantitative real-time polymerase chain reaction, minigene assay, and flow cytometry. Single-nucleotide polymorphisms rs2004640, rs10954213, and rs10488631 and the CGGGG insertion/deletion were genotyped in these patients. Genotypes of these polymorphisms defined both a common risk haplotype and a common protective haplotype. RESULTS: IRF-5 expression and alternative splicing were significantly up-regulated in SLE patients compared with healthy donors. Enhanced transcript and protein levels were associated with the risk haplotype of IRF5; rs10488631 displayed the only significant independent association that correlated with increased transcription from the noncoding first exon 1C. Minigene experiments demonstrated an important role for rs2004640 and the CGGGG insertion/deletion, along with type I IFNs, in regulating IRF5 expression. CONCLUSION: This study provides the first formal proof that IRF-5 expression and alternative splicing are significantly up-regulated in primary blood cells of patients with SLE. Furthermore, the risk haplotype is associated with enhanced IRF-5 transcript and protein expression in patients with SLE.
|
|
48. |
- Finke, Doreen, et al.
(författare)
-
Endogenous type I interferon inducers in autoimmune diseases
- 2009
-
Ingår i: Autoimmunity. - : Informa UK Limited. - 0891-6934 .- 1607-842X. ; 42:4, s. 349-352
-
Forskningsöversikt (refereegranskat)abstract
- Type I interferon (IFN) is produced by the innate immune system in several autoimmune diseases, such as systemic lupus erythematosus (SLE), polymyositis, and systemic sclerosis. In these diseases, immune complex (IC)-containing DNA or RNA may act as endogenous IFN inducers. The abilities of these IC to reach the endosomes in the plasmacytoid dendritic cells (PDC) cause the intracellular toll-like receptor (TLR) to initiate a cascade of transcription factors--a critical step in triggering type I IFN production. A special configuration of the nucleic acid (NA), such as CpG-rich non-methylated DNA or GU-rich RNA, appears crucial. However, other components of the IC, like HMGB1, may also be necessary. Studies regarding the genetic background of autoimmune diseases suggest that variants of genes involved in both IFN production and response are associated with disease susceptibility. This knowledge is important for the development of new therapeutic strategies in autoimmune diseases.
|
|
49. |
- Folkersen, Lasse, et al.
(författare)
-
Integration of known DNA, RNA and protein biomarkers provides prediction of anti-TNF response in rheumatoid arthritis : results from the COMBINE study.
- 2016
-
Ingår i: Molecular Medicine. - : Springer Science and Business Media LLC. - 1076-1551 .- 1528-3658. ; 22, s. 322-328
-
Tidskriftsartikel (refereegranskat)abstract
- OBJECTIVE: In rheumatoid arthritis (RA) several recent efforts have sought to discover means of predicting which patients would benefit from treatment. However, results have been discrepant with few successful replications. Our objective was to build a biobank with DNA, RNA and protein measurements to test the claim that the current state-of-the-art precision medicine will benefit RA patients.METHODS: We collected 451 blood samples from 61 healthy individuals and 185 RA patients initiating treatment, before treatment initiation and at a 3 month follow-up time. All samples were subjected to high-throughput RNA sequencing, DNA genotyping, extensive proteomics and flow cytometry measurements, as well as comprehensive clinical phenotyping. Literature review identified 2 proteins, 52 single-nucleotide polymorphisms (SNPs) and 72 gene-expression biomarkers that had previously been proposed as predictors of TNF inhibitor response (∆DAS28-CRP).RESULTS: From these published TNFi biomarkers we found that 2 protein, 2 SNP and 8 mRNA biomarkers could be replicated in the 59 TNF initiating patients. Combining these replicated biomarkers into a single signature we found that we could explain 51% of the variation in ∆DAS28-CRP. This corresponds to a sensitivity of 0.73 and specificity of 0.78 for the prediction of three month ∆DAS28-CRP better than -1.2.CONCLUSIONS: The COMBINE biobank is currently the largest collection of multi-omics data from RA patients with high potential for discovery and replication. Taking advantage of this we surveyed the current state-of-the-art of drug-response stratification in RA, and identified a small set of previously published biomarkers available in peripheral blood which predicts clinical response to TNF blockade in this independent cohort.
|
|
50. |
- Funseth, Eva, et al.
(författare)
-
Effects of coxsackievirus B3 infection on the acute-phase protein metallothionein and on cytochrome P-4501A1 involved in the detoxification processes of TCDD in the mouse
- 2002
-
Ingår i: Science of the Total Environment. - 0048-9697 .- 1879-1026. ; 284:1-3, s. 37-47
-
Tidskriftsartikel (refereegranskat)abstract
- During acute infections, the synthesis of acute-phase proteins and other proteins participating in the host defence are stimulated in the liver and kidney. In previous studies of coxsackievirus B3 (CB3) infection in mice, we found that cadmium (Cd) accumulates in the kidney, whereas 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) accumulates in the liver. To study if CB3 infection affects the synthesis of the Cd-binding protein metallothionein (MT) and the TCDD-binding/detoxifying cytochrome P-450 (CYP-450) isozyme CYP1A1, the basal and TCDD-induced levels of serum MT and liver CYP1A1 isozyme were determined in healthy and CB3-infected A/J mice. Furthermore, because interferons affect CYP450 activity, the serum levels of the interferons alpha (IFN-alpha) and -beta (IFN-beta) were measured in CB3-infected mice and in mice treated with the interferon-inducer polyinosinic/polycytidylic acid (poly I/C). Virus or poly I/C was administered intraperitoneally (i.p.) on day 0 and 500 ng TCDD/kg bodyweight on day 1. On day 4, CB3 infection had induced MT approximately 10-fold, regardless of TCDD treatment (P < 0.01 in infected mice and P < 0.001 in infected, TCDD-treated mice). TCDD alone induced a 10-fold increase in CYP1A1 activity (P < 0.001), whereas infection alone suppressed the normal CYP1A1 activity by 75% (P < 0.001). Infection also suppressed the TCDD-induced CYP1A1 activity by approximately 30% (n.s.). Poly I/C suppressed CYP1A1 by 20-25% (n.s.) at both basal and TCDD-induced levels. Serum IFN-alpha and IFN-beta levels were undetectable in controls, in TCDD-treated and in the poly I/C-treated groups on day 4, probably because the short IFN peak is detectable only hours after injection. Conversely, on day 4 of the infection, IFN-alpha and IFN-beta were consistently raised in the TCDD-treated infected mice, whereas increased IFNs as a result of infection alone could be detected in only one individual. These results suggest that the normal host responses during acute infections down-regulate detoxifying processes in favour of acute-phase protein synthesis. This may explain the observed changed pattern of accumulation, excretion and toxicity of the environmental pollutants cadmium and TCDD during this common virus infection.
|
|