SwePub
Sök i SwePub databas

  Extended search

Träfflista för sökning "WFRF:(Magnusson Mattias) "

Search: WFRF:(Magnusson Mattias)

  • Result 1-50 of 149
Sort/group result
   
EnumerationReferenceCoverFind
1.
  • Wikström, Frida Hasslung, et al. (author)
  • Structure-dependent modulation of alpha interferon production by porcine circovirus 2 oligodeoxyribonucleotide and CpG DNAs in porcine peripheral blood mononuclear cells.
  • 2007
  • In: Journal of virology. - : American Society for Microbiology. - 0022-538X .- 1098-5514. ; 81:10, s. 4919-27
  • Journal article (peer-reviewed)abstract
    • DNA sequences containing CpG motifs are recognized as immunomodulators in several species. Phosphodiester oligodeoxyribonucleotides (ODNs) representing sequences from the genome of porcine circovirus type 2 (PCV2) have been identified as potent inducers (ODN PCV2/5) or inhibitors (ODN PCV2/1) of alpha interferon (IFN-alpha) production by porcine peripheral blood mononuclear cells (poPBMCs) in vitro. In this study, the IFN-alpha-inducing or -inhibitory activities of specific phosphodiester ODNs were demonstrated to be dependent on their ability to form secondary structures. When a poly(G) sequence was added to a stimulatory self-complementary ODN, high levels of IFN-alpha were elicited, and the induction was not dependent on pretreatment with the transfecting agent Lipofectin. In addition, the IFN-alpha-inducing ODN required the presence of an intact CpG dinucleotide, whereas the inhibitory activity of ODN PCV2/1 was not affected by methylation or removal of the central CpG dinucleotide. Of particular significance, the IFN-alpha inhibition elicited by ODN PCV2/1 was only effective against induction stimulated by DNA control inducers and not RNA control inducers, indicating activity directed to TLR9 signaling. The PCV2 genome as a whole was demonstrated to induce IFN-alpha in cultures of poPBMCs, and the presence of immune modulatory sequences within the genome of PCV2 may, therefore, have implications with regard to the immune evasion mechanisms utilized by PCV2.
  •  
2.
  •  
3.
  • Gawel, Danuta, et al. (author)
  • A validated single-cell-based strategy to identify diagnostic and therapeutic targets in complex diseases
  • 2019
  • In: Genome Medicine. - : Springer Science and Business Media LLC. - 1756-994X. ; 11
  • Journal article (peer-reviewed)abstract
    • Background: Genomic medicine has paved the way for identifying biomarkers and therapeutically actionable targets for complex diseases, but is complicated by the involvement of thousands of variably expressed genes across multiple cell types. Single-cell RNA-sequencing study (scRNA-seq) allows the characterization of such complex changes in whole organs. Methods: The study is based on applying network tools to organize and analyze scRNA-seq data from a mouse model of arthritis and human rheumatoid arthritis, in order to find diagnostic biomarkers and therapeutic targets. Diagnostic validation studies were performed using expression profiling data and potential protein biomarkers from prospective clinical studies of 13 diseases. A candidate drug was examined by a treatment study of a mouse model of arthritis, using phenotypic, immunohistochemical, and cellular analyses as read-outs. Results: We performed the first systematic analysis of pathways, potential biomarkers, and drug targets in scRNA-seq data from a complex disease, starting with inflamed joints and lymph nodes from a mouse model of arthritis. We found the involvement of hundreds of pathways, biomarkers, and drug targets that differed greatly between cell types. Analyses of scRNA-seq and GWAS data from human rheumatoid arthritis (RA) supported a similar dispersion of pathogenic mechanisms in different cell types. Thus, systems-level approaches to prioritize biomarkers and drugs are needed. Here, we present a prioritization strategy that is based on constructing network models of disease-associated cell types and interactions using scRNA-seq data from our mouse model of arthritis, as well as human RA, which we term multicellular disease models (MCDMs). We find that the network centrality of MCDM cell types correlates with the enrichment of genes harboring genetic variants associated with RA and thus could potentially be used to prioritize cell types and genes for diagnostics and therapeutics. We validated this hypothesis in a large-scale study of patients with 13 different autoimmune, allergic, infectious, malignant, endocrine, metabolic, and cardiovascular diseases, as well as a therapeutic study of the mouse arthritis model. Conclusions: Overall, our results support that our strategy has the potential to help prioritize diagnostic and therapeutic targets in human disease.
  •  
4.
  •  
5.
  • Magnusson, Mattias, et al. (author)
  • Importance of CpG dinucleotides in activation of natural IFN-alpha-producing cells by a lupus-related oligodeoxynucleotide
  • 2001
  • In: Scandinavian Journal of Immunology. - : John Wiley & Sons. - 0300-9475 .- 1365-3083. ; 54:6, s. 543-550
  • Journal article (peer-reviewed)abstract
    • The oligodeoxyribonucleotide (ODN) 5-TTTTCAATTCGAAGATGAAT-3 (ODN H), identified in systemic lupus erythematosus (SLE) serum, induced the production of interferon (IFN)-alpha in human peripheral blood mononuclear cells (PBMC) when combined with lipofectin. Flow cytometric analysis with staining for surface antigens and intracellular IFN-alpha, showed that the IFN-alpha -producing cells (IPC) were the natural IPC, also termed type 2 dendritic cell precursors (pDC2) or plasmacytoid monocytes. The importance of unmethylated CpG dinucleotides for the interferogenic activity of ODN was studied. Methylation of CpG impaired the activity of single-stranded (ss) ODN H, but increased that of the complementary ssODN I. Furthermore, CpG-methylated double-stranded (ds) ODN H-met-I-met lost, but hemimethylated dsODN H-I-met retained interferogenic activity. Inversion of the CpG to GpC had no effect on the interferogenic activity of ssODN H, increased that of ssODN I, however abolished the activity of dsODN H-I. Alteration of the CpG in ODN H to ApG and in the ODN I to CpT destroyed their activity. The induction of IFN-alpha is therefore sequence-specific, but unmethylated CpGs are not always required, especially not in ssODNs. Interferogenic DNA sequences could therefore be more frequent in eukaryotic genomes than previously thought and their capacity to activate natural IPC may have implications for immune responses to microbial antigens and nuclear autoantigens.
  •  
6.
  •  
7.
  • Adolfsson, Daniel, 1992-, et al. (author)
  • TBV Radar SLAM - Trust but Verify Loop Candidates
  • 2023
  • In: IEEE Robotics and Automation Letters. - : IEEE. - 2377-3766. ; 8:6, s. 3613-3620
  • Journal article (peer-reviewed)abstract
    • Robust SLAM in large-scale environments requires fault resilience and awareness at multiple stages, from sensing and odometry estimation to loop closure. In this work, we present TBV (Trust But Verify) Radar SLAM, a method for radar SLAM that introspectively verifies loop closure candidates. TBV Radar SLAM achieves a high correct-loop-retrieval rate by combining multiple place-recognition techniques: tightly coupled place similarity and odometry uncertainty search, creating loop descriptors from origin-shifted scans, and delaying loop selection until after verification. Robustness to false constraints is achieved by carefully verifying and selecting the most likely ones from multiple loop constraints. Importantly, the verification and selection are carried out after registration when additional sources of loop evidence can easily be computed. We integrate our loop retrieval and verification method with a robust odometry pipeline within a pose graph framework. By evaluation on public benchmarks we found that TBV Radar SLAM achieves 65% lower error than the previous state of the art. We also show that it generalizes across environments without needing to change any parameters. We provide the open-source implementation at https://github.com/dan11003/tbv_slam_public
  •  
8.
  • Akesson, Alfred, et al. (author)
  • ComPOS : Composing Oblivious Services
  • 2019
  • In: 2019 IEEE International Conference on Pervasive Computing and Communications Workshops, PerCom Workshops 2019. - 9781538691519 ; , s. 132-138
  • Conference paper (peer-reviewed)abstract
    • Future internet-of-things systems need to be able to combine heterogeneous services and support weak connectivity. In this paper, we introduce ComPOS, a new domain-specific language for composing services in IoT systems. We show how Maria, a bird watcher, can use ComPOS to build a system that allows her to spy on birds in the garden while she is not at home. We demonstrate how ComPOS handles the unpredictable nature of IoT system by analysing in what cases Maria's system is still useful when some devices are unavailable.
  •  
9.
  • Ali, Abukar, 1988, et al. (author)
  • CTLA4-Ig but not anti-TNF therapy promotes staphylococcal septic arthritis in mice.
  • 2015
  • In: The Journal of infectious diseases. - : Oxford University Press (OUP). - 1537-6613 .- 0022-1899. ; 212:8, s. 1308-1316
  • Journal article (peer-reviewed)abstract
    • The development of biologics has greatly increased the quality of life as well as the life expectancy of many RA patients. However, a large number of these patients are at an increased risk of developing serious infections. The aim of this study was to examine differential effects of anti-TNF versus CTLA4-Ig treatment on both immunological response and host defense in a murine model of septic arthritis.
  •  
10.
  • Ali, Abukar, 1988, et al. (author)
  • IL-1 Receptor Antagonist Treatment Aggravates Staphylococcal Septic Arthritis and Sepsis in Mice.
  • 2015
  • In: PloS one. - : Public Library of Science (PLoS). - 1932-6203. ; 10:7
  • Journal article (peer-reviewed)abstract
    • Interleukin-1 receptor antagonist (IL-1Ra) is the primary therapy against autoinflammatory syndromes with robust efficacy in reducing systemic inflammation and associated organ injury. However, patients receiving IL-1Ra might be at increased risk of acquiring serious infections.
  •  
11.
  • Arwin, Hans, et al. (author)
  • Optical Chirality Determined from Mueller Matrices
  • 2021
  • In: Applied Sciences. - : MDPI. - 2076-3417. ; 11:15
  • Journal article (peer-reviewed)abstract
    • Featured Application The analysis of the transmission of Mueller matrices facilitates studies of optical activity in samples that also exhibit linear anisotropy and depolarization and may have a multilayered structure. Such studies are important for the development of applications in chiroptics. Optical chirality, in terms of circular birefringence and circular dichroism, is described by its electromagnetic and magnetoelectric material tensors, and the corresponding optical activity contributes to the Mueller matrix. Here, spectroscopic ellipsometry in the spectral range 210-1690 nm is used to address chiral phenomena by measuring Mueller matrices in transmission. Three approaches to determine chirality parameters are discussed. In the first approach, applicable in the absence of linear polarization effects, circular birefringence and circular dichroism are evaluated directly from elements of a Mueller matrix. In the second method, differential decomposition is employed, which allows for the unique separation of chirality parameters from linear anisotropic parameters as well as from depolarization provided that the sample is homogeneous along the optical path. Finally, electromagnetic modeling using the Tellegen constitutive relations is presented. The last method also allows structural effects to be included. The three methods to quantify optical chirality are demonstrated for selected materials, including sugar solutions, alpha-quartz, liquid crystals, beetle cuticle, and films of cellulose nanocrystals.
  •  
12.
  • Ask, Urban, 1956, et al. (author)
  • IT Governance in the light of Paradox - A Social System Theory Perspective
  • 2006
  • In: The 40th Hawaii International Conference on System Sciences, 2007.
  • Conference paper (peer-reviewed)abstract
    • This paper uses Niclas Luhmann's concepts of paradox and deparadoxization as a starting point for looking at IT governance within large, Swedish organizations. All in all a total of 25 organizations within both the public and private sector have been investigated through interviews with the companies Chief Information Officers. The results are presented in relation to a number of areas within the study that could be identified as dichotomies, or areas where the respondents had to deal with conflicting logics. The results are discussed in general terms in relation to IT governance practice as well as the potential value of applying Luhmann's theory of social systems to the study of IT governance
  •  
13.
  • Baudet, Aurelie, et al. (author)
  • RNAi screen identifies MAPK14 as a druggable suppressor of human hematopoietic stem cell expansion.
  • 2012
  • In: Blood. - : American Society of Hematology. - 1528-0020 .- 0006-4971. ; 119:26, s. 6255-6258
  • Journal article (peer-reviewed)abstract
    • We report on a forward RNAi screen in primary human hematopoietic stem and progenitor cells, using pooled lentiviral shRNA libraries deconvoluted by next generation sequencing. We identify MAPK14/p38α as a modulator of ex vivo stem cell proliferation and show that pharmacological inhibition of p38 dramatically enhances the stem cell activity of cultured umbilical cord blood derived hematopoietic cells. p38 inhibitors should thus be considered in strategies aiming at expanding stem cells for clinical benefit.
  •  
14.
  •  
15.
  • Baudet, Aurélie, et al. (author)
  • Small Molecule Screening of Primary Human Acute Myeloid Leukemia Using Co-culture and Multiplexed FACS Analysis
  • 2022
  • In: Bio-protocol. - 2331-8325. ; 12:6
  • Journal article (peer-reviewed)abstract
    • Ex vivo culture of primary acute myeloid leukemia (AML) cells is notoriously difficult due to spontaneous differentiation and cell death, which hinders mechanistic and translational studies. To overcome this bottleneck, we have implemented a co-culture system, where the OP9-M2 stromal cells support the growth, but most notably limit the differentiation of primary AML cells, thus allowing for mechanistic studies in vitro. Additionally, the co-culture on OP9-M2 stromal is superior in preserving surface marker expression of primary (adult and pediatric) AML cells in comparison to stroma-free culture. Thus, by combining the co-culture with multicolor, high-throughput FACS, we can evaluate the effect of hundreds of small molecules on multi-parametric processes including: cell survival, stemness (leukemic stem cells), and myeloid differentiation on the primary AML cells at a single-cell level. This method streamlines the identification of potential therapeutic agents, but also facilitates combinatorial screening aiming, for instance, at dissecting the regulatory pathways in a patient-specific manner.
  •  
16.
  • Bergström, Göran, et al. (author)
  • Self-Report Tool for Identification of Individuals With Coronary Atherosclerosis : The Swedish CardioPulmonary BioImage Study
  • In: Journal of the American Heart Association. - 2047-9980. ; , s. 1-13
  • Journal article (peer-reviewed)abstract
    • BACKGROUND: Coronary atherosclerosis detected by imaging is a marker of elevated cardiovascular risk. However, imaging involves large resources and exposure to radiation. The aim was, therefore, to test whether nonimaging data, specifically data that can be self-reported, could be used to identify individuals with moderate to severe coronary atherosclerosis.METHODS AND RESULTS: We used data from the population-based SCAPIS (Swedish CardioPulmonary BioImage Study) in individuals with coronary computed tomography angiography (n=25 182) and coronary artery calcification score (n=28 701), aged 50 to 64 years without previous ischemic heart disease. We developed a risk prediction tool using variables that could be assessed from home (self-report tool). For comparison, we also developed a tool using variables from laboratory tests, physical examinations, and self-report (clinical tool) and evaluated both models using receiver operating characteristic curve analysis, external validation, and benchmarked against factors in the pooled cohort equation. The self-report tool (n=14 variables) and the clinical tool (n=23 variables) showed high-to-excellent discriminative ability to identify a segment involvement score ≥4 (area under the curve 0.79 and 0.80, respectively) and significantly better than the pooled cohort equation (area under the curve 0.76, P<0.001). The tools showed a larger net benefit in clinical decision-making at relevant threshold probabilities. The self-report tool identified 65% of all individuals with a segment involvement score ≥4 in the top 30% of the highest-risk individuals. Tools developed for coronary artery calcification score ≥100 performed similarly. CONCLUSIONS: We have developed a self-report tool that effectively identifies individuals with moderate to severe coronary atherosclerosis. The self-report tool may serve as prescreening tool toward a cost-effective computed tomography-based screening program for high-risk individuals.
  •  
17.
  • Berndt, Sonja I., et al. (author)
  • Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture
  • 2013
  • In: Nature Genetics. - : Springer Science and Business Media LLC. - 1061-4036 .- 1546-1718. ; 45:5, s. 501-U69
  • Journal article (peer-reviewed)abstract
    • Approaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of body mass index, height and waist-to-hip ratio, as well as clinical classes of obesity, including up to 263,407 individuals of European ancestry, we identified 4 new loci (IGFBP4, H6PD, RSRC1 and PPP2R2A) influencing height detected in the distribution tails and 7 new loci (HNF4G, RPTOR, GNAT2, MRPS33P4, ADCY9, HS6ST3 and ZZZ3) for clinical classes of obesity. Further, we find a large overlap in genetic structure and the distribution of variants between traits based on extremes and the general population and little etiological heterogeneity between obesity subgroups.
  •  
18.
  • Bian, Li, et al. (author)
  • Dichloroacetate alleviates development of collagen II-induced arthritis in female DBA/1 mice
  • 2009
  • In: ARTHRITIS RESEARCH and THERAPY. - : BioMed Central. - 1478-6354 .- 1478-6362. ; 11:5
  • Journal article (peer-reviewed)abstract
    • Introduction Dichloroacetate (DCA) has been in clinical use for the treatment of lactacidosis and inherited mitochondrial disorders. It has potent anti-tumor effects both in vivo and in vitro, facilitating apoptosis and inhibiting proliferation. The proapoptotic and anti-proliferative properties of DCA prompted us to investigate the effects of this compound in arthritis. Methods In the present study, we used DCA to treat murine collagen type II (CII)-induced arthritis (CIA), an experimental model of rheumatoid arthritis. DBA/1 mice were treated with DCA given in drinking water. Results Mice treated with DCA displayed much slower onset of CIA and significantly lower severity (P less than 0.0001) and much lower frequency (36% in DCA group vs. 86% in control group) of arthritis. Also, cartilage and joint destruction was significantly decreased following DCA treatment (P = 0.005). Moreover, DCA prevented arthritis-induced cortical bone mineral loss. This clinical picture was also reflected by lower levels of anti-CII antibodies in DCA-treated versus control mice, indicating that DCA affected the humoral response. In contrast, DCA had no effect on T cell-or granulocyte-mediated responses. The beneficial effect of DCA was present in female DBA/1 mice only. This was due in part to the effect of estrogen, since ovariectomized mice did not benefit from DCA treatment to the same extent as sham-operated controls (day 30, 38.7% of ovarectomized mice had arthritis vs. only 3.4% in sham-operated group). Conclusion Our results indicate that DCA delays the onset and alleviates the progression of CIA in an estrogen-dependent manner.
  •  
19.
  • Bjoerstroem, Cecilia M., et al. (author)
  • Multilayer formation in spin-coated thin films of low-bandgap polyfluorene: PCBM blends
  • 2005
  • In: Journal of Physics: Condensed Matter. ; 17:50, s. L529-L534
  • Journal article (peer-reviewed)abstract
    • Blends of the low-bandgap polymer poly[(9,9-dioctylfluorenyl-2,7-diyl)-co-5,5-(4',7'-di-2-thienyl- 2',1',3'-benzothiadiazole)] (APFO-3) and the fullerene deriv. [6,6]-phenyl-C61-butyric acid Me ester (PCBM) were spin-coated from chloroform soln. into thin films, which were examd. with dynamic secondary ion mass spectrometry. For blends with high PCBM content, the depth profiles show compn. waves that were caused by surface-directed phase sepn. during spin-coating. The formation of such multilayer structures by spontaneous self-stratification probably has implications for optimization strategies for the performance of org. solar cells. [on SciFinder (R)]
  •  
20.
  • Björnsson, Jon Mar, et al. (author)
  • Reduced proliferative capacity of hematopoietic stem cells deficient in hoxb3 and hoxb4
  • 2003
  • In: Blood. - 0006-4971 .- 1528-0020. ; 23:11, s. 3872-3883
  • Journal article (peer-reviewed)abstract
    • Several homeobox transcription factors, such as HOXB3 and HOXB4, have been implicated in regulation of hematopoiesis. In support of this, studies show that overexpression of HOXB4 strongly enhances hematopoietic stem cell regeneration. Here we find that mice deficient in both Hoxb3 and Hoxb4 have defects in endogenous hematopoiesis with reduced cellularity in hematopoietic organs and diminished number of hematopoietic progenitors without perturbing lineage commitment. Analysis of embryonic day 14.5 fetal livers revealed a significant reduction in the hematopoietic stem cell pool, suggesting that the reduction in cellularity observed postnatally is due to insufficient expansion during fetal development. Primitive Lin(-) Scal(+) c-kit(+) hematopoietic progenitors lacking Hoxb3 and Hoxb4 displayed impaired proliferative capacity in vitro. Similarly, in vivo repopulating studies of Hoxb3/Hoxb4-deficient hematopoietic cells resulted in lower repopulating capability compared to normal littermates. Since no defects in homing were observed, these results suggest a slower regeneration of mutant HSC. Furthermore, treatment with cytostatic drugs demonstrated slower cell cycle kinetics of hematopoietic stem cells deficient in Hoxb3 and Hoxb4, resulting in increased tolerance to antimitotic drugs. Collectively, these data suggest a direct physiological role of Hoxb4 and Hoxb3 in regulating stem cell regeneration and that these genes are required for maximal proliferative response.
  •  
21.
  • Björström, Cecilia M., et al. (author)
  • Multilayer formation in spin-coated thin films of low-bandgap polyfluorene:PCBM blends
  • 2005
  • In: Journal of Physics. - Philadelphia : Institute of Physics Publishing (IOPP). - 0953-8984 .- 1361-648X. ; 17:50, s. L529-L534
  • Journal article (peer-reviewed)abstract
    • Blends of the low-bandgap polymer poly[(9,9-dioctylfluorenyl-2,7-diyl)-co-5,5- (4',7'-di-2-thienyl-2',1',3'-benzothiadiazole] (APFO-3) and the fullerene derivative [6,6]-phenyl–C61–butyric acid methyl ester (PCBM) were spin-coated from chloroform solution into thin films, which were examined with dynamic secondary ion mass spectrometry. For blends with high PCBM content, the depth profiles show composition waves that were caused by surface-directed phase separation during spin-coating. The formation of such multilayer structures by spontaneous self-stratification is likely to have implications for optimization strategies for the performance of organic solar cells
  •  
22.
  • Blank Savukinas, Ulrika, et al. (author)
  • Smad7 promotes self-renewal of hematopoietic stem cells in vivo.
  • 2006
  • In: Blood. - : American Society of Hematology. - 1528-0020 .- 0006-4971. ; 108:13, s. 4246-4254
  • Journal article (peer-reviewed)abstract
    • The Smad-signaling pathway downstream of the transforming growth factor–beta superfamily of ligands is an evolutionarily conserved signaling circuitry with critical functions in a wide variety of biologic processes. To investigate the role of this pathway in the regulation of hematopoietic stem cells (HSCs), we have blocked Smad signaling by retroviral gene transfer of the inhibitory Smad7 to murine HSCs. We report here that the self-renewal capacity of HSCs is promoted in vivo upon blocking of the entire Smad pathway, as shown by both primary and secondary bone marrow (BM) transplantations. Importantly, HSCs overexpressing Smad7 have an unperturbed differentiation capacity as evidenced by normal contribution to both lymphoid and myeloid cell lineages, suggesting that the Smad pathway regulates self-renewal independently of differentiation. Moreover, phosphorylation of Smads was inhibited in response to ligand stimulation in BM cells, thus verifying impairment of the Smad-signaling cascade in Smad7-overexpressing cells. Taken together, these data reveal an important and previously unappreciated role for the Smad-signaling pathway in the regulation of self-renewal of HSCs in vivo.
  •  
23.
  • Blomberg, Stina, et al. (author)
  • Expression of the markers BDCA-2 and BDCA-4 and production of interferon-alpha by plasmacytoid dendritic cells in systemic lupus erythematosus
  • 2003
  • In: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 48:9, s. 2524-32
  • Journal article (peer-reviewed)abstract
    • OBJECTIVE: To study the expression of blood dendritic cell antigen 2 (BDCA-2) and BDCA-4 molecules by plasmacytoid dendritic cells (PDCs) in the blood of patients with systemic lupus erythematosus (SLE), and to study PDC production of interferon-alpha (IFN alpha) and its inhibition by anti-BDCA-2 and anti-BDCA-4 antibodies. METHODS: Peripheral blood mononuclear cells (PBMCs) from SLE patients (SLE PBMCs) and from healthy controls were induced to produce IFN alpha in vitro by SLE serum containing an endogenous IFN alpha-inducing factor (SLE-IIF) or by herpes simplex virus type 1 (HSV-1). The frequencies and numbers of BDCA-2-, BDCA-3-, and BDCA-4-expressing cells were analyzed by flow cytometry, and the effects of anti-BDCA-2 and anti-BDCA-4 monoclonal antibodies (mAb) on IFN alpha production were investigated. RESULTS: IFN alpha production by SLE PBMCs induced by SLE-IIF or HSV-1 was decreased compared with that of healthy control PBMCs (P = 0.002 and P = 0.0007, respectively). The proportions of BDCA-2- and BDCA-3-expressing cells in SLE PBMCs were reduced compared with those in PBMCs from healthy controls (P = 0.01 and P = 0.004, respectively). IFN alpha producers in culture, especially among SLE PBMCs, displayed reduced BDCA-2 expression and constituted only a minority of the BDCA-2-positive cells, at least in healthy control PBMCs (median 18%). IFN alpha production by both SLE and healthy control PBMCs stimulated by SLE-IIF or HSV-1 was markedly reduced by anti-BDCA-2 mAb (median 81-98% inhibition). Anti-BDCA-4 mAb only partially inhibited SLE-IIF-induced IFN alpha production. CONCLUSION: SLE patients had a reduced number of BDCA-2-expressing PDCs, also termed natural IFN alpha-producing cells, and their IFN alpha production could be inhibited by anti-BDCA-2/4 mAb. Such mAb may be a therapeutic option for inhibiting the ongoing IFN alpha production in SLE patients.
  •  
24.
  • Bokarewa, Maria, 1963, et al. (author)
  • Arthritogenic dsRNA is present in synovial fluid from rheumatoid arthritis patients with an erosive disease course.
  • 2008
  • In: European journal of immunology. - : Wiley. - 0014-2980 .- 1521-4141. ; 38:11, s. 3237-44
  • Journal article (peer-reviewed)abstract
    • Viruses may be part of the pathogenesis of rheumatoid arthritis (RA). Double stranded RNA (dsRNA) is a prototypic viral conformation of nucleic acid that is highly arthritogenic in mice. Therefore, we developed an ELISA to detect dsRNA in sera and synovial fluids (SF) in RA patients and in osteoarthritic controls. The developed ELISA recognizes picogram levels of viral or synthetic dsRNA but shows no reactivity against DNA, synthetic ssRNA, or total RNA prepared from mammalian cells. Before analysis by ELISA, each sample was subjected to RNA precipitation. The RA patients had significantly higher levels of dsRNA than the osteoarthritis patients in SF and in sera. In 7 of 17 RA patients, EBV was present in SF and in all but one of these this was accompanied by the presence of dsRNA. No parvovirus, cytomegalovirus, or polyomavirus was detected. The anti-viral cytokine IFN-alpha was detected in SF in 10 of 21 RA patients, but in none of the osteoarthritis patients. Notably, RA patients with erosive disease course had significantly higher levels of dsRNA in SF than non-erosive patients, but no correlation between dsRNA levels and the presence of RF or levels of C-reactive protein, IL-6, or IFN-alpha was observed.
  •  
25.
  • Bokarewa, Maria, 1963, et al. (author)
  • Pathological survivin expression links viral infections with pathogenesis of erosive rheumatoid arthritis.
  • 2007
  • In: Scandinavian journal of immunology. - : Wiley. - 0300-9475 .- 1365-3083. ; 66:2-3, s. 192-8
  • Research review (peer-reviewed)abstract
    • Rheumatoid arthritis (RA) is an inflammatory joint disease leading to cartilage and bone destruction. Insufficient apoptosis in the inflamed RA synovium along with accumulation of highly differentiated B- and T-lymphocytes as well as invasive growth of macrophages and fibroblasts is among the major mechanisms supporting joint destruction. We have recently shown that circulating survivin, an apoptosis inhibitor tightly bound to tumorigenesis, is an independent predictor of development and progression of joint destruction in RA. In this review we discuss the possible connectivity between viral infection, leading to interferon (IFN)-alpha production, survivin expression, and subsequent joint inflammation. The role of IFN-alpha and the involvement of IFN transcription factors and phosphoinositide-3-kinase signalling as essential modulators of arthritogenic process are discussed in the context of survivin.
  •  
26.
  • Bradshaw, Clare, et al. (author)
  • Bottom trawling resuspends sediment and releases bioavailable contaminants in a polluted fjord
  • 2012
  • In: Environmental Pollution. - : Elsevier BV. - 0269-7491 .- 1873-6424. ; 170, s. 232-241
  • Journal article (peer-reviewed)abstract
    • Sediments are sinks for contaminants in the world's oceans. At the same time, commercial bottom trawling is estimated to affect around 15 million km(2) of the world's seafloor every year. However, few studies have investigated whether this disturbance remobilises sediment-associated contaminants and, if so, whether these are bioavailable to aquatic organisms. This field study in a trawled contaminated Norwegian fjord showed that a single 1.8 km long trawl pass created a 3-5 million m(3) sediment plume containing around 9 t contaminated sediment; ie. 200 g dw m(-2) trawled, equivalent to c. 10% of the annual gross sedimentation rate. Substantial amounts of PCDD/Fs and non-ortho PCBs were released from the sediments, likely causing a semi-permanent contaminated sediment suspension in the bottom waters. PCDD/Fs from the sediments were also taken up by mussels which, during one month, accumulated them to levels above the EU maximum advised concentration for human consumption.
  •  
27.
  • Brun, Ann, et al. (author)
  • Hoxb4-deficient mice undergo normal hematopoietic development but exhibit a mild proliferation defect in hematopoietic stem cells
  • 2004
  • In: Blood. - : American Society of Hematology. - 1528-0020 .- 0006-4971. ; 103:11, s. 4126-4133
  • Journal article (peer-reviewed)abstract
    • Enforced expression of Hoxb4 dramatically increases the regeneration of murine hematopoietic stem cells (HSCs) after transplantation and enhances the repopulation ability of human severe combined immunodeficiency (SCID) repopulating cells. Therefore, we asked what physiologic role Hoxb4 has in hematopoiesis. A novel mouse model lacking the entire Hoxb4 gene exhibits significantly reduced cellularity in spleen and bone marrow (BM) and a subtle reduction in red blood cell counts and hemoglobin values. A mild reduction was observed in the numbers of primitive progenitors and stem cells in adult BM and fetal liver, whereas lineage distribution was normal. Although the cell cycle kinetics of primitive progenitors was normal during endogenous hematopoiesis, defects in proliferative responses of BM Lin(-) Sca1(+) c-kit(+) stem and progenitor cells were observed in culture and in vivo after the transplantation of BM and fetal liver HSCs. Quantitative analysis of mRNA from fetal liver revealed that a deficiency of Hoxb4 alone changed the expression levels of several other Hox genes and of genes involved in cell cycle regulation. In summary, the deficiency of Hoxb4 leads to hypocellularity in hematopoietic organs and impaired proliferative capacity. However, Hoxb4 is not required for the generation of HSCs or the maintenance of steady state hematopoiesis.
  •  
28.
  • Båve, Ullvi, et al. (author)
  • Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG
  • 2003
  • In: Journal of Immunology. - : American Association of Immunologists. - 0022-1767 .- 1550-6606. ; 171:6, s. 3296-302
  • Journal article (peer-reviewed)abstract
    • An ongoing production of IFN-alpha may be of etiopathogenic significance in systemic lupus erythematosus (SLE). It may be due to the natural IFN-producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), activated by immune complexes that contain nucleic acids derived from apoptotic cells. We here examined the role of FcgammaR in the IFN-alpha production in vitro by PBMC induced by the combination of apoptotic U937 cells and autoantibody-containing IgG from SLE patients (SLE-IgG). The Fc portion of the SLE-IgG was essential to induce IFN-alpha production, because Fab fragments or F(ab')(2) were ineffective. Normal, especially heat-aggregated, IgG inhibited the IFN-alpha production, suggesting a role for FcgammaR on PBMC. Using blocking anti-FcgammaR Abs, the FcgammaRIIa,c (CD32) but not FcgammaRI or FcgammaRIII were shown to be involved in the IFN-alpha induction by apoptotic cells combined with SLE-IgG, but not by HSV or CpG DNA. In contrast, the action of all of these inducers was inhibited by the anti-FcgammaRIIa,b,c mAb AT10 or heat-aggregated IgG. Flow cytometric analysis revealed that approximately 50% of the BDCA-2-positive PBMC, i.e., NIPC/PDC, expressed low but significant levels of FcgammaRII, as did most of the actual IFN-alpha producers activated by HSV. RT-PCR applied to NIPC/PDC purified by FACS demonstrated expression of FcgammaRIIa, but not of FcgammaRIIb or FcgammaRIIc. We conclude that FcgammaRIIa on NIPC/PDC is involved in the activation of IFN-alpha production by interferogenic immune complexes, but may also mediate inhibitory signals. The FcgammaRIIa could therefore have a key function in NIPC/PDC and be a potential therapeutic target in SLE.
  •  
29.
  •  
30.
  • Caër, Charles, et al. (author)
  • TREM-1+ Macrophages Define a Pathogenic Cell Subset in the Intestine of Crohn's Disease Patients
  • 2021
  • In: Journal of Crohn's &amp; colitis. - : Oxford University Press (OUP). - 1876-4479 .- 1873-9946. ; 15:8, s. 1346-1361
  • Journal article (peer-reviewed)abstract
    • BACKGROUND AND AIMS: Uncontrolled activation of intestinal mononuclear phagocytes [MNPs] drives chronic inflammation in inflammatory bowel disease [IBD]. Triggering receptor expressed on myeloid cells 1 [TREM-1] has been implicated in the pathogenesis of IBD. However, the role of TREM-1+ cell subsets in driving IBD pathology and the link with clinical parameters are not understood. We investigated TREM-1 expression in human intestinal MNP subsets and examined blocking TREM-1 as a potential IBD therapy. METHODS: TREM-1 gene expression was analysed in intestinal mucosa, enriched epithelial and lamina propria [LP] layers, and purified cells from controls and IBD patients. TREM-1 protein on immune cells was assessed by flow cytometry and immunofluorescence microscopy. Blood monocyte activation was examined by large-scale gene expression using a TREM-1 agonist or LP conditioned media [LP-CM] from patients in the presence or absence of TREM-1 and tumour necrosis factor [TNF] antagonist antibodies. RESULTS: TREM-1 gene expression increases in intestinal mucosa from IBD patients and correlates with disease score. TREM-1+ cells, which are mainly immature macrophages and CD11b+ granulocytes, increase among LP cells from Crohn's disease patients and their frequency correlates with inflammatory molecules in LP-CM. LP-CM from Crohn's disease patients induces an inflammatory transcriptome in blood monocytes, including increased IL-6 expression, which is reduced by simultaneous blocking of TREM-1 and TNF. CONCLUSIONS: High intestinal TREM-1 expression, reflecting a high frequency of TREM-1+ immature macrophages and TREM-1+CD11b+ granulocytes, is linked to the deleterious inflammatory microenvironment in IBD patients. Therefore, blocking the TREM-1 pathway, especially simultaneously with anti-TNF therapy, has potential as a new IBD therapy.
  •  
31.
  • Chalise, Jaya Prakash, et al. (author)
  • IDO1 and TGF- 1 β mediate protective effects of IFN-α in antigen-induced arthritis
  • Other publication (other academic/artistic)abstract
    • Interferon-α (IFN-α) prevents antigen-induced arthritis (AIA) in mice by an unknown mechanism. Indoleamine 2, 3 dioxygenase 1 (IDO1) is an immunoregulator via enzymatic as well as signalling activity, which can be activated by TGF-β and further mediated via non canonical NF-κB signalling. We here investigated whether IDO1 and TGF-β are involved in IFN-α protective effects in AIA. Arthritis was induced in wt, Ido1-/- or Ifnar-/- mice, treated or not with IFN-α or kynurenine, the main IDO1 product, and antibodies neutralizing TGF-β or 1-methyltryptophan (1-MT), an inhibitor of IDO1 catalytic activity. IDO1 expression and enzymatic activity were determined by RT-PCR and HPLC, respectively. Proliferation was measured by 3H-Thymidine incorporation. Non-canonical NF-κB signalling was evaluated by ELISA and Western blot in plasmacytoid DCs (pDCs) from treated mice. Protective effects of IFN-α in AIA were associated with increased IDO1 expression and kynurenine production in spleen cells, particularly at the time of mBSA sensitization. Lack of IDO1 ablated IFN-α protection and kynurenine prevented AIA in an IFNAR-independent manner. The IDO1 catalytic activity was crucial for IFN-α effects at the sensitization but not effector phase of AIA. The disease effector phase in mice treated with IFN-α was instead characterized by sustained IDO1 and TGF-β expression and activation of the noncanonical NF-κB pathway in pDCs. IFN-α protective effects in AIA involves IDO1 enzymatic and signalling activity in the disease sensitization and effector phase, respectively. Kynurenine, the main IDO1 metabolite, can be used as an alternative treatment to IFN-α in protecting mice from AIA.
  •  
32.
  • Chalise, Jaya Prakash (author)
  • Immune tolerance by interferon-alpha in experimental arthritis
  • 2015
  • Doctoral thesis (other academic/artistic)abstract
    • Type I Interferons (mainly IFN-α & IFN-β) belong to a family of cytokines that possess strong antiviral and immunomodulatory properties. Pro- and/or anti-inflammatory effects of type I IFN have been observed in infectious diseases and several autoimmune diseases including SLE, MS, RA and experimental models thereof, but what defines either outcome is largely obscure. The main aim of this thesis is to understand how IFN-α may act anti-inflammatory in a model of antigen-induced arthritis (AIA). In this model, mice are sensitised with methylated-BSA (mBSA) emulsified in Freund’s adjuvant at day 1 and 7 followed by intra-articular injection of mBSA in the knee joint at day 21, which induces arthritis within 1 week.Administration of IFN-α at the time of mBSA sensitisations (day 1 and day 7) but not at induction of arthritis (day 21) clearly protected against arthritis in a type I IFN receptor dependent manner. Humoral immunity might not be involved in this protection as the levels of antigen-specific IgG (total, IgG1, IgG2a and IgG2b), IgA, IgE in serum were not altered in IFN-α treated mice. However, IFN-α-protection was accompanied by delayed and decreased antigen-specific proliferative responses in spleen and lymph node cells ex vivo, including impaired proliferative recall responses after intra-articular antigenic challenge.In the course of AIA, IFN-α inhibited the increase of circulatory IL-6, IL-10, IL-12, and TNF in the sensitisation phase (day 0-21) and also the re-call response of IL-1β, IL-10, IL-12, TNF, IFN-γ, and IL-17 induced by intra-articular mBSA challenge in arthritis phase (day 21-28). This IFN-α-inhibition of cytokines was also apparent in mBSA-re-stimulated spleen and lymph node cell cultures ex vivo, including inhibited cytokine production in CD4+ T helper cells and macrophages. In contrast to the inhibition of pro-inflammatory cytokines, the levels of immunomodulatory TGF-β was clearly enhanced in IFN-α-treated mice, both in serum and in re-stimulated leucocytes cultures including both macrophages, especially in the sensitisation phase, and in CD4+ T cells in the arthritis phase. By  inhibiting TGF-β signalling in vivo, the protective effect of IFN-α was  shown to be dependent on TGF-β signalling in the sensitisation phase.The cytokine TGF-β is an activator of the indoleamine 2,3 dioxygnese (IDO1), a potent immuneregulatory component that acts via enzymatic production of kynurenine (Kyn) and signalling activity. The IFN-α-protective effect in AIA was associated with both increased expression and enzymatic activity of IDO1 and the IFN-α-protection was totally ablated in mice lacking IDO1 expression (IDO1 KO mice) and in mice treated with the inhibitor of the enzymatic activity of IDO1 (1-Methyl Tryptophan; 1-MT). Interestingly, administration of the IDO-metabolite Kyn protected mice from AIA in an IFNARindependent manner. These observations show that the IDO1 enzymatic activity is important for the protective effect of IFN-α. Using 1-MT, it was further shown that the enzymatic activity of IDO1 was, like TGF-β, crucial only at the sensitisation but not in the arthritis phase of AIA for IFN-α to protect against arthritis. Instead, IDO1’s non-enzymatic signalling activity, characterized by sustained expression of IDO1 and non-canonical NF-κB activation in pDCs, was observed in the arthritis phase in spleen cells from mice treated with IFN-α.Regulatory T cells (Treg cells) were also found to be important for IFN-α-protection in AIA. Transient depletion of Treg cells by diphtheria toxin in DEREG mice in the arthritis phase, but not during the sensitisation phase abolished IFN-α-protection. Treatment with IFN-α enhanced the numbers of Treg cells in the course of AIA and their function; compared to untreated mice, Treg cells isolated at day 10 and 20 of AIA from IFN-α- treated mice exhibited higher suppressive activity against mBSA-stimulated proliferation of responder T cells. The enhancing effect of IFN-α on Treg cell numbers was observed in blood, spleen, LNs and also in ex-vivo cultures of leucocytes re-stimulated with mBSA and IFN-α. Although IFN-α clearly increased the suppressive activity of Treg cells, adoptive transfer of Treg cells from mBSA immunized mice, regardless of IFN-α treatment, prevented the development of arthritis.ConclusionIn the presence of IFN-α during antigen sensitisation, a state of tolerance is established, which is able to prevent joint inflammation induced by antigenic re-challenge. This immunological tolerance is created in the sensitisation phase of AIA and is characterized by inhibition of pro-inflammatory cytokines, increased TGF-β production and activity of the IDO1 enzyme, the latter two being indispensable for IFN-α-induced protection. Administration of Kyn, the metabolite of the enzymatic activity of IDO1, in the sensitisation phase also protected against AIA downstream of type I IFN signalling. In the arthritis phase regulatory T cells, whose numbers and suppressive capacity was clearly enhanced by IFN-α, mediate the actual prevention of arthritis development in IFN-α-treated animals. We have thus identified molecular and cellular components of the anti-inflammatory program elicited by IFN-α including Kyn that may not have the pro-inflammatory effects associated with IFN.
  •  
33.
  • Chalise, Jaya Prakash, et al. (author)
  • Interferon alpha inhibits antigen-specific production of proinflammatory cytokines and enhances antigen-specific transforming growth factor beta production in antigen-induced arthritis
  • 2013
  • In: Arthritis Research and Therapy. - London, UK : BioMed Central. - 1478-6354. ; 15:5, s. R143-
  • Journal article (peer-reviewed)abstract
    • Introduction: Interferon alpha (IFN-α) has a complex role in autoimmunity, in that it may both enhance and prevent inflammation. We have previously shown that the presence of IFN-α at sensitization protects against subsequent antigen-triggered arthritis. To understand this tolerogenic mechanism, we performed a descriptive, hypothesis-generating study of cellular and humoral responses associated with IFN-α-mediated protection against arthritis.Methods: Arthritis was evaluated at day 28 in mice given a subcutaneous injection of methylated bovine serum albumin (mBSA), together with Freund adjuvant and 0 to 5,000 U IFN-α at days 1 and 7, followed by intraarticular injection of mBSA alone at day 21. The effect of IFN-α on mBSA-specific IgG1, IgG2a, IgG2b, IgA, and IgE was evaluated by enzyme-linked immunosorbent assay (ELISA). Cytokines in circulation and in ex vivo cultures on mBSA restimulation was evaluated with ELISA and Luminex, and the identity of cytokine-producing cells by fluorescence-activated cell sorting (FACS) analysis.Results: Administration of IFN-α protected mice from arthritis in a dose-dependent manner but had no effect on antigen-specific antibody levels. However, IFN-α did inhibit the initial increase of IL-6, IL-10, IL-12, and TNF, and the recall response induced by intraarticular mBSA challenge of IL-1β, IL-10, IL-12, TNF, IFN-γ, and IL-17 in serum. IFN-α decreased both macrophage and CD4+ T cell-derived IFN-γ production, whereas IL-17 was decreased only in CD4+ T cells. Ex vivo, in mBSA-restimulated spleen and lymph node cell cultures, the inhibitory effect of in vivo administration of IFN-α on proinflammatory cytokine production was clearly apparent, but had a time limit. An earlier macrophage-derived, and stronger activation of the antiinflammatory cytokine transforming growth factor beta (TGF-β) was observed in IFN-α-treated animals, combined with an increase in CD4+ T cells producing TGF-β when arthritis was triggered by mBSA (day 21). Presence of IFN-α at immunizations also prevented the reduction in TGF-β production, which was induced by the intraarticular mBSA injection triggering arthritis in control animals.Conclusions: Administration of IFN-α has a profound effect on the cellular response to mBSA plus adjuvant, but does not affect antigen-specific Ig production. By including IFN-α at immunizations, spleen and lymph node cells inhibit their repertoire of antigen-induced proinflammatory cytokines while enhancing antiinflammatory TGF-β production, first in macrophages, and later also in CD4+ T cells. On intraarticular antigen challenge, this antiinflammatory state is reenforced, manifested as inhibition of proinflammatory recall responses and preservation of TGF-β levels. This may explain why IFN-α protects against antigen-induced arthritis. © 2013 Chalise et al.; licensee BioMed Central Ltd.
  •  
34.
  • Chalise, Jaya Prakash, et al. (author)
  • Regulatory T cells manifest IFN-α mediated protection during antigen induced arthritis
  • Other publication (other academic/artistic)abstract
    • IntroductionType I interferon induces tolerance against arthritogenic antigen and protects against antigen induced arthritis (AIA). Regulatory T cells (Treg cells) resolve aberrant immune reaction, maintain self-tolerance and prevent the development of autoimmune diseases. We here investigated the impact of Interferon alpha (IFN-α) on Treg cells development and function during antigen induced arthritis.MethodsFor AIA, mice were immunized with methylated bovine serum albumin (mBSA) at day 1 and 7 in presence or absence of IFN-α. At day 21, arthritis was induced by intra-articular injection of mBSA and arthritis was evaluated at day 28. At various days of AIA, CD4, CD25, Foxp3 and CTLA-4 expression was quantified by FACS in blood cells, splenocytes, lymph nodes cells and in ex vivo re-stimulated leucocytes (pooled splenocytes and lymph nodes cells) isolated at same days. To investigate the importance of Treg cells in IFN-α protection in AIA, Foxp3DTReGFP+mice were used, where Treg cells can be depleted transiently by administration of diptherin toxin. CFSE based suppression assay was used to assess the suppression by Treg cells isolated day 4, 10, 20 of AIA against proliferation of mBSA or anti-CD3 stimulated responder T cells (Tresp cells) isolated at same days. For adoptive transfer experiments, 250,000 Treg cells from IFN-α treated or untreated mice day 20 of AIA were intravenously injected to recipient pre-immunized mice without IFN-α treatment during the induction of arthritis. The importance of IFN-α signalling on T cells for the IFN-α protection was evaluated by using CD4-Cre+/- IFNAR flox/flox mice.ResultsProtective effects of IFN-α in AIA were associated with significant TGF-β dependent increase in Foxp3+ T cells in blood at day 4 and minor increase of Foxp3+T cells in spleen and lymph node cells. However IFN-α signalling in T cells is not required for IFN-α-protection. Upon ex vivo re-stimulation in presence of IFN-α with mBSA but not anti-CD3, the Treg cells numbers were increased in leucocytes isolated from day 4 and day 10 of AIA. Transient depletion of Treg cells during induction of arthritis (day 21) abolished IFN-α-protection however the protection was not affected when Treg cells are depleted during immunization phase (day 1 and day 7). Against mBSA-stimulated proliferation of Tresp cells, suppression by Treg cells isolated from day 10 and day 20 from IFN-α treated mice are significantly higher than Treg cells from untreated mice. Treg cells isolated from IFN-α or untreated mice at day 20 of AIA when transferred to pre-immunized untreated mice prevent the development of arthritis.ConclusionTreg cells are critically associated with IFN-α protective effects in AIA. IFN-α enhances TGF-β dependent early development of Treg cells and later IFN-α enhances their suppressive capacity against T cells proliferation in antigen specific manner during AIA.
  •  
35.
  • Chenna Narendra, Sudeep, et al. (author)
  • Local but Not Systemic Administration of Uridine Prevents Development of Antigen-Induced Arthritis
  • 2015
  • In: PLOS ONE. - : PUBLIC LIBRARY SCIENCE. - 1932-6203. ; 10:10, s. e0141863-
  • Journal article (peer-reviewed)abstract
    • Objective Uridine has earlier been show to down modulate inflammation in models of lung inflammation. The aim of this study was to evaluate the anti-inflammatory effect of uridine in arthritis. Methods Arthritis was induced by intra-articular injection of mBSA in the knee of NMRI mice preimmunized with mBSA. Uridine was either administered locally by direct injection into the knee joint or systemically. Systemic treatment included repeated injections or implantation of a pellet continuously releasing uridine during the entire experimental procedure. Anti-mBSA specific immune responses were determined by ELISA and cell proliferation and serum cytokine levels were determined by Luminex. Immunohistochemistry was used to identify cells, study expression of cytokines and adhesion molecules in the joint. Results Local administration of 25-100 mg/kg uridine at the time of arthritis onset clearly prevented development of joint inflammation. In contrast, systemic administration of uridine (max 1.5 mg uridine per day) did not prevent development of arthritis. Protection against arthritis by local administration of uridine did not affect the anti-mBSA specific immune response and did not prevent the rise in serum levels of pro-inflammatory cytokines associated with the triggering of arthritis. In contrast, local uridine treatment efficiently inhibited synovial expression of ICAM-1 and CD18, local cytokine production and recruitment of leukocytes to the synovium. Conclusion Local, but not systemic administration of uridine efficiently prevented development of antigen- induced arthritis. The protective effect did not involve alteration of systemic immunity to mBSA but clearly involved inhibition of synovial expression of adhesion molecules, decreased TNF and IL-6 production and prevention of leukocyte extravasation. Further, uridine is a small, inexpensive molecule and may thus be a new therapeutic option to treat joint inflammation in RA.
  •  
36.
  • Chenna Narendra, Sudeep, et al. (author)
  • Regulatory T-Cells Mediate IFN-alpha-Induced Resistance against Antigen-Induced Arthritis
  • 2018
  • In: Frontiers in Immunology. - : FRONTIERS MEDIA SA. - 1664-3224. ; 9
  • Journal article (peer-reviewed)abstract
    • Objective: CD4(+)FoxP3(+)CD25(+) regulatory T-cells (T-regs) are important for preventing tissue destruction. Here, we investigate the role of T-regs for protection against experimental arthritis by IFN-alpha. Methods: Arthritis was triggered by intra-articular injection of methylated bovine serum albumin (mBSA) in wild-type mice, Foxp3DTReGFP(+/-) mice [allowing selective depletion of T-regs by diphtheria toxin (DT)] and CD4-Cre(+/-) IFNA1R flox/flox mice (devoid of IFNAR signaling in T-cells) earlier immunized with mBSA, with or without treatment with IFN-alpha or the indoleamine 2,3-dioxygenase (IDO)-metabolite kynurenine. T-regs were depleted in DT-treated Foxp3DTReGFP(+/-) mice and enumerated by FoxP3 staining. Suppressive capacity of FACS-sorted CD25(+high)CD4(+) T-regs was tested in vivo by adoptive transfer and ex vivo in cocultures with antigen-stimulated CFSE-stained T-responder (CD25-CD4(+)) cells. IDO was inhibited by 1-methyl tryptophan. Results: Both control mice and mice devoid of IFNAR-signaling in T helper cells were protected from arthritis by IFN-alpha. Depletion of T-regs in the arthritis phase, but not at immunization, abolished the protective effect of IFN-alpha and kynurenine against arthritis. IFN-alpha increased the number of T-regs in ex vivo cultures upon antigen recall stimulation but not in naive cells. IFN-alpha also increased the suppressive capacity of T-regs against mBSA-induced T-responder cell proliferation ex vivo and against arthritis when adoptively transferred. The increased suppressive activity against proliferation conferred by IFN-alpha was clearly reduced by in vivo inhibition of IDO at immunization, which also abolished the protective effect of IFN-alpha against arthritis. Conclusion: By activating IDO during antigen sensitization, IFN-alpha activates T-regs, which prevent arthritis triggered by antigen rechallenge. This is one way by which IFN-alpha suppresses inflammation.
  •  
37.
  • Chenna Narendra, Sudeep (author)
  • Systemic and local regulation of experimental arthritis by IFN-α, dendritic cells and uridine
  • 2017
  • Doctoral thesis (other academic/artistic)abstract
    • In this thesis, we have studied the immunological processes of joint inflammation that may be targets for future treatment of patients with arthritis. We focus on the immune-modulating properties of interferon-α (IFN-α) and uridine in experimental arthritis. The nucleoside uridine, which is regarded a safe treatment has anti-inflammatory properties notably by inhibiting tumor necrosis factor (TNF) release. Because the inflamed synovium in rheumatoid arthritis (RA) is characterised by pathogenic TNF-production, uridine could potentially be away to ameliorate arthritis. Systemic administration of uridine had no effect on antigeninduced arthritis (AIA), which is a T-cell dependent model where animals are immunized twice (sensitization) with bovine serum albumin (mBSA), before local triggering of arthritis by intra-articular antigen (mBSA) re-challenge. In contrast, intra-articular administration of uridine clearly down modulated development of AIA in a dose dependent manner and inhibited the expression of synovial adhesion molecules, influx of inflammatory leukocytes and synovial expression of TNF and interleukin 6, but did not affect systemic levels of proinflammatory cytokines or antigen-specific T-cell responses. Local administration of uridine may thus be a viable therapeutic option for treatment of arthritis in the future.Viral double-stranded deoxyribonucleic acid (dsRNA), a common nucleic acid found in most viruses, can be found in the joints of RA patients and local deposition of such viral dsRNA induces arthritis by activating IFN-α. Here we show that arthritis induced by dsRNA can be mediated by IFN-producing dendritic cells in the joint and this may thus explain why viral infections are sometimes associated with arthritis.Earlier, to study the effect of dsRNA and IFN-α in an arthritis model, that like RA, is dependent on adaptive immunity, dsRNA and IFN-α were administered individually during the development of AIA. Both molecules clearly protected against AIA in a type I IFN receptor-dependent manner but were only effective if administered in the sensitization phase of AIA. Here we show that the anti-inflammatory effect of IFN-α is critically dependent on signalling via transforming growth factor β (TGF-β) and the enzymatic activity of indoleamine 2,3 dioxygenase 1 (IDO). The IDO enzyme is produced by plasmacytoid DC and this cell type was critically required both during antigen sensitization and in the arthritis phase of AIA for the protective effect of IFN-α against AIA. In contrast, TGF-β and the enzymatic activity of IDO were only required during sensitization, which indicate that they are involved in initial steps of tolerogenic antigen sensitization. In this scenario, IFN- α first activates the enzymatic activity of IDO in pDC, which converts Tryptophan to Kynurenine, which thereafter activates TGF-β. Common for IDO-expressing pDC, Kyn and TGF-β is their ability to induce development of regulatory T cells (Tregs). We found that Tregs were crucial for IFN-α-mediated protection against AIA, but only in the arthritis phase. In line with this, adoptive transfer of Tregs isolated from IFN-α treated mice to recipient animals in the arthritis phase clearly protected against AIA. The numbers of Tregs were not significantly altered by IFN-α but IFN-α increased the suppressive capacity of Tregs against antigen-induced proliferation. This enhanced suppressive activity of Tregs in the arthritis phase was dependent on the earlier activated enzyme IDO1 during the sensitization phase of AIA. Thus, presence of IFN-α at the time of antigen sensitization activates the enzymatic activity of IDO, which generates Tregs with enhanced suppressive capacity that upon antigen re-challenge prevents inflammation. We have thus identified one example of how immune tolerance can be developed, that may be a future way to combat autoimmunity.
  •  
38.
  • Claesson, Erik, et al. (author)
  • Carbide Precipitation during Processing of Two Low-Alloyed Martensitic Tool Steels with 0.11 and 0.17 V/Mo Ratios Studied by Neutron Scattering, Electron Microscopy and Atom Probe
  • 2022
  • In: Metals. - Basel, Switzerland : MDPI AG. - 2075-4701. ; 12:5
  • Journal article (peer-reviewed)abstract
    • Two industrially processed low-alloyed martensitic tool steel alloys with compositions Fe-0.3C-1.1Si-0.81Mn-1.5Cr-1.4Ni-1.1Mo-0.13V and Fe-0.3C-1.1Si-0.81Mn-1.4Cr-0.7Ni-0.8Mo-0.14V (wt.%) were characterized using small-angle neutron scattering (SANS), scanning electron microscopy (SEM), Scanning transmission electron microscopy (STEM), and atom probe tomography (APT). The combination of methods enables an understanding of the complex precipitation sequences that occur in these materials during the processing. Nb-rich primary carbides form at hot working, while Fe-rich auto-tempering carbides precipitate upon quenching, and cementite carbides grow during tempering when Mo-rich secondary carbides also nucleate and grow. The number density of Mo-rich carbides increases with tempering time, and after 24 h, it is two to three orders of magnitude higher than the Fe-rich carbides. A high number density of Mo-rich carbides is important to strengthen these low-alloyed tool steels through precipitation hardening. The results indicate that the Mo-rich secondary carbide precipitates are initially of MC character, whilst later they start to appear as M2C. This change of the secondary carbides is diffusion driven and is therefore mainly seen for longer tempering times at the higher tempering temperature of 600◦C.
  •  
39.
  • Claesson, Erik, et al. (author)
  • Evolution of iron carbides during tempering of low-alloy tool steel studied with polarized small angle neutron scattering, electron microscopy and atom probe
  • 2022
  • In: Materials Characterization. - : Elsevier BV. - 1044-5803 .- 1873-4189. ; 194, s. 112464-112464
  • Journal article (peer-reviewed)abstract
    • The magnetic scattering of iron carbides in low-alloy tool steel was investigated ex-situ by polarized small angle neutron scattering measurements after tempering the steel at 550 °C and 600 °C. Magnetic features could be detected in the as-quenched sample resulting in a negative interference term, believed to be either θ-Fe3C, η-Fe2C, or ε-Fe2-3C. During tempering the evolution of cementite could be studied by the variation of the interference term and in γ-ratio, which is the ratio of the magnetic to nuclear scattering length density contrast. From scanning transmission electron microscopy (STEM) and atom probe tomography, it is evident that cementite (θ-Fe3C) is present directly when reaching the tempering temperature of either 550 °C or 600 °C. At longer tempering times, cementite gets enriched with substitutional elements like chromium and manganese, forming an enriched shell on the cementite particles. STEM and energy dispersive x-ray spectrometry show that the chemical composition of small cementite particles approaches that of Cr-rich M7C3 carbides after 24 h at 600 °C. It is also seen that small non-magnetic particles precipitate during tempering and these correspond well with molybdenum and vanadium-rich carbides.
  •  
40.
  •  
41.
  • Dehlin, Mats, 1968, et al. (author)
  • Intra-articular fms-like tyrosine kinase 3 ligand expression is a driving force in induction and progression of arthritis.
  • 2008
  • In: PLoS ONE. - : Public Library of Science (PLoS). - 1932-6203. ; 3:11
  • Journal article (peer-reviewed)abstract
    • BACKGROUND: One of the hallmarks of rheumatoid arthritis (RA) is hyperplasia and inflammation of the synovial tissue being characterized by in situ occurrence of highly differentiated leukocytes. Fms-like tyrosine kinase 3 (Flt3) has a crucial role in hematopoiesis, regulation of cell proliferation, differentiation and apoptosis. Typically, Flt3 is expressed on early myeloid and lymphoid progenitors and is activated by its soluble ligand (Flt3-L). The highly differentiated cellular pattern in the synovium of the RA patients made us hypothesize that Flt3-L, with its ability to induce proliferation and differentiation, could be of importance in induction and/or progression of arthritis. METHODOLOGY/PRINCIPAL FINDINGS: To investigate occurrence of Flt3-L in RA we have measured its levels in matched serum and synovial fluid samples from 130 patients and 107 controls. To analyse the pro-inflammatory role of Flt3-L, we continuously overexpressed this protein locally in healthy mouse joints using homologous B-cell line transfected with Flt3-L gene. Additionally, recombinant Flt3-L was instillated intra-articularly in combination with peptidoglycans, a Toll Like Receptor 2-ligand with stong arthritogenic properties. Our results show significantly higher levels of Flt3-L in the synovial fluid as compared to serum levels in RA subjects (p = 0.0001). In addition, RA synovial fluid levels of Flt-3-L were significantly higher than these obtained from synovial fluids originating from non-inflammatory joint diseases (p = 0.022). Intra-articular administration of B-cell line transfected with Flt3-L gene resulted in highly erosive arthritis while inoculation of the same B-cell line without hyperexpression of Flt3-L did not induce erosivity and only in a minority of cases caused synovial proliferation! Flt3-ligand potentiated peptidoglycan induced arthritis as compared to mice injected with peptidoglycan alone (p<0.05). CONCLUSIONS/SIGNIFICANCE: Our findings indicate that Flt3-L is strongly expressed at the site of inflammation in human RA. It exerts both pro-inflammatory and tissue destructive properties once in the joint cavity. Owing to these properties, treatment attempts to neutralize this molecule should be considered in RA.
  •  
42.
  • Domeika, Kristina, et al. (author)
  • Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
  • 2004
  • In: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102
  • Journal article (peer-reviewed)abstract
    • The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
  •  
43.
  • Fan, Xiaolong, et al. (author)
  • Transient disruption of autocrine TGF-beta signaling leads to enhanced survival and proliferation potential in single primitive human hemopoietic progenitor cells.
  • 2002
  • In: Journal of Immunology. - 1550-6606. ; 168:2, s. 755-762
  • Journal article (peer-reviewed)abstract
    • Hemopoietic stem cells (HSCs) are maintained at relative quiescence by the balance between the positive and negative regulatory factors that stimulate or inhibit their proliferation. Blocking the action of negative regulatory factors may provide a new approach for inducing HSCs into proliferation. A variety of studies have suggested that TGF-beta negatively regulates cell cycle progression of HSCs. In this study, a dominant negatively acting mutant of TGF-beta type II receptor (TbetaRIIDN) was transiently expressed in HSCs by using adenoviral vector-mediated gene delivery, such that the effects of disrupting the autocrine TGF-beta signaling in HSCs can be directly examined at a single cell level. Adenoviral vectors allowing the expression of TbetaRIIDN and green fluorescence protein in the same CD34(+)CD38(-)Lin(-) cells were constructed. Overexpression of TbetaRIIDN specifically disrupted TGF-beta-mediated signaling. Autocrine TGF-beta signaling in CD34(+)CD38(-)Lin(-) cells was studied in single cell assays under serum-free conditions. Transient blockage of autocrine TGF-beta signaling in CD34(+)CD38(-)Lin(-) cells enhanced their survival. Furthermore, the overall proliferation potential and proliferation kinetics in these cells were significantly enhanced compared with the CD34(+)CD38(-)Lin(-) cells expressing green fluorescence protein alone. Therefore, we have successfully blocked the autocrine TGF-beta-negative regulatory loop of primitive hemopoietic progenitor cells.
  •  
44.
  • Fei, Ying, et al. (author)
  • The combination of a tumor necrosis factor inhibitor and antibiotic alleviates staphylococcal arthritis and sepsis in mice.
  • 2011
  • In: The Journal of infectious diseases. - : Oxford University Press (OUP). - 1537-6613 .- 0022-1899. ; 204:3, s. 348-57
  • Journal article (peer-reviewed)abstract
    • (See the editorial commentary by Chow, on pages 332-4) Background.Despite advances in medical practices, in recent decades permanent reductions in joint function have not been achieved, and the high mortality rate of patients with staphylococcal septic arthritis has not substantially improved. Methods.We evaluated the effects of a combined tumor necrosis factor (TNF) inhibitor and antibiotic therapy on the course of Staphylococcus aureus arthritis and sepsis in mice. Results.Treatment with the combination of a TNF inhibitor and an antibiotic resulted in a quicker relief of clinical arthritis in mice with septic arthritis, compared with an antibiotic monotherapy. Both histopathologically verified synovitis and the extent of joint destruction were reduced by this combined treatment. Importantly, anti-TNF treatment significantly improved the survival rate of mice with S. aureus sepsis and staphylococcal enterotoxin shock syndrome; this effect might be the result of a partial restoration of the hemostatic balance between coagulation and fibrinolysis. Finally, we demonstrated that anti-TNF treatment downregulates high-mobility group protein B1 in staphylococcal enterotoxin shock syndrome. Conclusions.Thus, simultaneous systemic TNF inhibition and antibiotic therapy has beneficial effects on the outcome of S. aureus arthritis and sepsis in a mouse model, suggesting that the combination of a TNF inhibitor and antibiotics represents a novel therapeutic strategy for the treatment of staphylococcal infections.
  •  
45.
  • Forsman, Huamei, et al. (author)
  • Galectin 3 Aggravates Joint Inflammation and Destruction in Antigen-Induced Arthritis
  • 2011
  • In: ARTHRITIS AND RHEUMATISM. - : John Wiley and Sons, Ltd. - 0004-3591 .- 1529-0131. ; 63:2, s. 445-454
  • Journal article (peer-reviewed)abstract
    • Objective. Galectin 3, an endogenous beta galactoside-binding lectin, plays an important role in the modulation of immune responses. The finding that galectin 3 is present in the inflamed synovium in patients with rheumatoid arthritis suggests that the protein is associated with the pathogenesis of this disease. We undertook this study to investigate the influence of galectin 3 deficiency in a murine model of arthritis. Methods. Wild-type (WT) and galectin 3-deficient (galectin 3(-/-)) mice were subjected to antigen-induced arthritis (AIA) through immunization with methylated bovine serum albumin. The concentration of serum cytokines (interleukin-6 [IL-6] and tumor necrosis factor alpha [TNF alpha]) and antigen-specific antibodies was evaluated using a cytometric bead array platform and enzyme-linked immunosorbent assay (ELISA). Cellular IL-17 responses were examined by flow cytometry, ELISA, and enzyme-linked immunospot assay. Results. The joint inflammation and bone erosion of AIA were markedly suppressed in galectin 3(-/-) mice as compared with WT mice. The reduced arthritis in galectin 3(-/-) mice was accompanied by decreased levels of antigen-specific IgG and proinflammatory cytokines. The frequency of IL-17-producing cells in the spleen was reduced in galectin 3(-/-) mice as compared with WT mice. Exogenously added recombinant galectin 3 could partially restore the reduced arthritis and cytokines in galectin 3(-/-) mice. Conclusion. Our findings show that galectin 3 plays a pathogenic role in the development and progression of AIA and that the disease severity is accompanied by alterations of antigen-specific IgG levels, systemic levels of TNF alpha and IL-6, and frequency of IL-17-producing T cells. To our knowledge, this is the first report of in vivo evidence that galectin 3 plays a crucial role in the development of arthritis.
  •  
46.
  • Fransson, J.E.S., et al. (author)
  • Detection of clear-cuts using ALOS PALSAR satellite images
  • 2008
  • In: Proceedings of the European Conference on Synthetic Aperture Radar, EUSAR. - 2197-4403. ; 1-4
  • Conference paper (peer-reviewed)abstract
    • The objective of this study is to make a first evaluation of the possibilities to detect forest clear-cuts using high-resolution ALOS PALSAR FBD (Fine Beam Dual polarization) satellite images. New operational applications for mapping of changes in forest cover are of interest for government authorities in Sweden and in other countries with similar needs. The study was conducted in southern Sweden and included seven old coniferous stands located on flat terrain. Three of the stands were clear-felled and the remaining stands were left untreated for reference. Altogether, six PALSAR FBD images (look angle 34.3°, HH- and HV-polarization) acquired during the summer and fall seasons were analyzed. The difference in backscattering coefficient between the reference and the clear-felled stands was on average 2.4 dB and 2.9 dB for the HH- and HV-polarization, respectively. When comparing the backscattering coefficient before and after clear-felling the drop was found to be 1.7 dB and 2.3 dB for the HH- and HV-polarization, respectively.
  •  
47.
  • Fredriksson, Sofie, 1983, et al. (author)
  • The Impact of Occupational Noise Exposure on Hyperacusis: a Longitudinal Population Study of Female Workers in Sweden.
  • 2021
  • In: Ear and Hearing. - 1538-4667. ; 43:4, s. 1366-1377
  • Journal article (peer-reviewed)abstract
    • The aim was to assess the risk of hyperacusis in relation to occupational noise exposure among female workers in general, and among women working in preschool specifically.A retrospective longitudinal study was performed. Survey data were collected in 2013 and 2014 from two cohorts: randomly selected women from the population in region Västra Götaland, Sweden, and women selected based on having received a preschool teacher degree from universities in the same region. The final study sample included n = 8328 women born between 1948 and 1989. Occupational noise exposure was objectively assigned to all time periods from the first to the last reported occupation throughout working life, using the Swedish Job-Exposure Matrix (JEM) with three exposure intervals: <75 dB(A), 75 to 85 dB(A), and >85 dB(A). The JEM assigns preschool teachers to the 75 to 85 dB(A) exposure interval. The outcome hyperacusis was assessed by self-report using one question addressing discomfort or pain from everyday sounds. In the main analysis, a hyperacusis event was defined by the reported year of onset, if reported to occur at least a few times each week. Additional sensitivity analyses were performed using more strict definitions: (a) at least several times each week and (b) every day. The risk (hazard ratio, HR) of hyperacusis was analyzed in relation to years of occupational noise exposure, using survival analysis with frailty regression modeling accounting for individual variation in survival times which reflect, for example, noise exposure during years prior to onset. Occupational noise exposure was defined by the occupation held at year of hyperacusis onset, or the occupation held at the survey year if no event occurred. Models were adjusted for confounders including age, education, income, family history of hearing loss, and change of jobs due to noise.In total, n = 1966 hyperacusis events between 1960 and 2014 were analyzed in the main analysis. A significantly increased risk of hyperacusis was found among women working in any occupation assigned to the 75 to 85 dB(A) noise exposure group [HR: 2.6, 95% confidence interval (CI): 2.4-2.9], compared with the reference group <75 dB(A). The risk was tripled among preschool teachers specifically (HR: 3.4, 95% CI: 3.0-3.7), with the crude Kaplan-Meier curve showing a higher rate of onset early in the working life in preschool teachers compared with all the other exposure groups. The risk was increased, but not statistically significant in the main analysis, for the highest exposure group >85 dB(A), where only six hyperacusis events were identified (HR: 1.4, 95% CI: 0.6-3.1). In the sensitivity analysis, where hyperacusis was defined as occurring every day, the HR was significant also in the highest exposure group (HR: 3.8, 95% CI: 1.4-10.3), and generally slightly higher in the other exposure groups compared to the main analysis.This study indicates increased risk of hyperacusis already below the permissible occupational noise exposure limit in Sweden (85 dB LAeq,8h) among female workers in general, and in particular among preschool teachers. Prospective studies and less wide exposure intervals could confirm causal effects and assess dose-response relationships, respectively, although this study at present suggest a need for risk assessment, improved hearing prevention measures, and noise abatement measures in occupations with noise levels from 75 dB(A). The results could also have implications for management of occupational disability claims.
  •  
48.
  • Gorreja, Frida, et al. (author)
  • MEFV and NLRP3 Inflammasome Expression Is Attributed to Immature Macrophages and Correlates with Serum Inflammatory Proteins in Crohn ' s Disease Patients
  • 2022
  • In: Inflammation. - : Springer Science and Business Media LLC. - 0360-3997 .- 1573-2576. ; 45, s. 1631-1650
  • Journal article (peer-reviewed)abstract
    • Inflammasomes are intracellular protein complexes whose activation results in proinflammatory cytokines. Inflammasomes are implicated in Crohn ' s disease (CD) pathogenesis, yet the contribution of inflammasomes in intestinal epithelial cells (IECs) versus lamina propria (LP) macrophages is poorly understood. Whether inflammasome expression in intestinal tissue reflects the serum inflammatory protein profile of patients is also not known. We aimed to determine the intestinal cell types where inflammasome expression is increased in CD and if they correlate with the serum protein profile. RT-PCR and NanoString nCounter technology were used to characterize inflammasome gene expression in CD patients and controls. The mucosa, LP and IEC cell fractions and FACS-sorted cells were analyzed. Proximity extension assay with a 92-protein panel was used to determine the serum inflammatory protein profile. Compositional analysis was used to correlate ileum inflammasome gene expression with intestinal mononuclear phagocyte populations. We show that NLRP3 and MEFV inflammasome sensors and downstream effector expression including IL-1 beta are increased in inflamed mucosa of IBD patients and correlate with disease activity. Inflammasome gene expression increased with the abundance of immature intestinal macrophages, and increased IL-1 beta released by CD LP cells correlated with immature macrophage frequency. Inflammasome gene expression was also increased in circulating monocytes, the precursors of immature intestinal macrophages. Finally, the serum inflammatory profile of CD patients correlates with ileal expression of genes related to NLRP3 and MEFV inflammasomes. Overall, we show that MEFV and NLRP3 inflammasome expression in CD intestine is attributed to the accumulation of immature macrophages and correlates with serum inflammatory proteins.
  •  
49.
  • Gregori, Giulia, et al. (author)
  • Limosilactobacillus reuteri 6475 and Prevention of Early Postmenopausal Bone Loss: A Randomized Clinical Trial
  • 2024
  • In: JAMA Network Open. - : AMER MEDICAL ASSOC. - 2574-3805. ; 7:6
  • Journal article (peer-reviewed)abstract
    • Importance Daily supplementation with the probiotic Limosilactobacillus reuteri ATCC PTA 6475 (L reuteri) vs placebo has previously been demonstrated to reduce bone loss in an estrogen deficiency mice model and older women, although the magnitude of the effect was small. We hypothesized that long-term treatment with L reuteri could result in clinically relevant skeletal benefits in postmenopausal osteoporosis. Objective To evaluate whether daily supplementation with L reuteri vs placebo could reduce early postmenopausal bone loss and whether the effects remained or increased over time during 2 years of treatment. Design, Setting, and Participants A double-blind, randomized, placebo-controlled clinical trial was conducted between December 4, 2019, and October 6, 2022, at a single center in Gothenburg, southwestern Sweden. Participants were recruited by online advertisements, and letters were sent to 10 062 women aged 50 to 60 years. Responding women (n = 752) underwent telephone screening, resulting in 292 women being invited to a screening visit. Of those who were screened, 239 women met all inclusion criteria and had no exclusion criteria. Interventions Capsules with L reuteri in 2 doses, 5 x 108 (low dose) or 5 x 109 (high dose) colony-forming units, taken twice daily or placebo were administered. All capsules also included cholecalciferol, 200 IU. Main Outcomes and MeasuresThe primary outcome was the relative change in tibia total volumetric bone mineral density (vBMD) over 2 years. Secondary outcomes included relative change in areal BMD of the lumbar spine and total hip, bone turnover markers C-terminal telopeptide cross-links of collagen type I and type I procollagen intact N-terminal propeptide, as well as tibia trabecular bone volume fraction and cortical vBMD. Both intention-to-treat and per-protocol analyses were conducted. Results A total of 239 postmenopausal women (median age, 55 [IQR, 53-56] years) were included. Tibia vBMD (primary outcome), hip and spine vBMD, and tibia cortical area and BMD decreased significantly in all groups, with no group-to-group differences (percent change tibia vBMD high dose vs placebo least-squares means, -0.08 [95 CI, -0.85 to 0.69] and low dose vs placebo least-squares means, -0.22 [95% CI, -0.99 to 0.55]). There were no significant treatment effects on any other predefined outcomes. A prespecified sensitivity analysis found a significant interaction between body mass index (BMI) and treatment effect at 2 years. No significant adverse effects were observed. Conclusions and Relevance In this randomized clinical trial of 239 early postmenopausal women, supplementation with L reuteri had no effect on bone loss or bone turnover over 2 years. The observed interaction between BMI and treatment effect warrants further investigation. Trial RegistrationClinicalTrials.gov Identifier: NCT04169789
  •  
50.
  • Henning, Petra, 1974, et al. (author)
  • Adenovirus type 5 fiber knob domain has a critical role in fiber protein synthesis and encapsidation
  • 2006
  • In: JOURNAL OF GENERAL VIROLOGY. - : Microbiology Society. - 0022-1317 .- 1465-2099. ; 87, s. 3151-3160
  • Journal article (peer-reviewed)abstract
    • Adenovirus serotype 5 (Ad5) vectors carrying knobless fibers designed to remove their natural tropism were found to have a lower fiber content than recombinant Ad5 with wild-type (WT) capsid, implying a role for the knob-coding sequence or/and the knob domain in fiber encapsidation. Experimental data using a variety of fiber gene constructs showed that the defect did not occur at the fiber mRNA level, but at the protein level. Knobless fiber proteins were found to be synthesized at a significant slower rate compared with knob-carrying fibers, and the trimerization process of knobless fibers paralleled their slow rate of synthesis. A recombinant Ad5 diploid for the fiber gene (referred to as Ad5/R7-ZZwt/E1 : WT-fiber) was constructed to analyse the possible rescue of the knobless low-fiber-content phenotype by co-expression of WT fiber. Ad5/R7-ZZwt/E1 : WT-fiber contained a knobless fiber gene in its natural location (L5) in the viral genome and an additional WT fiber gene in an ectopic position in E1. Knobless fiber was still synthesized at low levels compared with the co-expressed E1 : WT fiber and the recovery of the two fiber species in virus progeny reflected their respective amounts in the infected cells. Our results suggested that deletion of the fiber knob domain had a negative effect on the translation of the fiber mRNA and on the intracellular concentration of fiber protein. They also suggested that the knob control of fiber protein synthesis and encapsidation occurred as aciseffect, which was not modified by WT fiber protein providedin transby the same Ad5 genome.
  •  
Skapa referenser, mejla, bekava och länka
  • Result 1-50 of 149
Type of publication
journal article (114)
conference paper (17)
doctoral thesis (5)
research review (4)
reports (3)
other publication (3)
show more...
book chapter (2)
editorial collection (1)
show less...
Type of content
peer-reviewed (127)
other academic/artistic (18)
pop. science, debate, etc. (4)
Author/Editor
Lorentzon, Mattias, ... (12)
Karlsson, Stefan (12)
Larsson, Jonas (11)
Ohlsson, Claes, 1965 (10)
Tarkowski, Andrej, 1 ... (9)
Lind, Lars (8)
show more...
Karlsson, Göran (7)
Teumer, A (7)
Bokarewa, Maria, 196 ... (7)
Kutalik, Z. (7)
Lehtimaki, T. (7)
Snieder, H. (7)
Nordahl, Mattias (7)
Magnusson, Boris (7)
Peters, A (6)
Langenberg, C. (6)
Tanaka, T. (6)
Vandenput, Liesbeth, ... (6)
Fischer, K. (6)
Marklund, Mattias, 1 ... (6)
Ferrucci, L (6)
Hofman, A (6)
Laakso, M. (6)
Josefsson, Elisabet, ... (6)
Sinisalo, J. (5)
Boomsma, DI (5)
Pedersen, NL (5)
van Duijn, CM (5)
Groop, Leif (5)
Loos, RJF (5)
Eloranta, Maija-Leen ... (5)
Gudnason, V (5)
Montgomery, GW (5)
Uitterlinden, AG (5)
Volzke, H (5)
Martin, NG (5)
Froguel, P (5)
Johansson, Åsa (5)
Kanoni, S (5)
Nolte, IM (5)
Hamsten, A (5)
Dedoussis, G. (5)
Grallert, H. (5)
Vollenweider, P. (5)
Waldenberger, M. (5)
Deloukas, P. (5)
Campbell, H (5)
Kuusisto, J. (5)
Jin, Tao, 1973 (5)
Gyllensten, Ulf (5)
show less...
University
Lund University (58)
Linköping University (56)
University of Gothenburg (43)
Karolinska Institutet (17)
Uppsala University (16)
Chalmers University of Technology (15)
show more...
Umeå University (7)
Royal Institute of Technology (7)
Swedish University of Agricultural Sciences (5)
Stockholm University (4)
Luleå University of Technology (3)
Högskolan Dalarna (2)
Örebro University (1)
Karlstad University (1)
show less...
Language
English (143)
Swedish (5)
Undefined language (1)
Research subject (UKÄ/SCB)
Medical and Health Sciences (76)
Natural sciences (36)
Engineering and Technology (20)
Social Sciences (6)
Agricultural Sciences (5)
Humanities (1)

Year

Kungliga biblioteket hanterar dina personuppgifter i enlighet med EU:s dataskyddsförordning (2018), GDPR. Läs mer om hur det funkar här.
Så här hanterar KB dina uppgifter vid användning av denna tjänst.

 
pil uppåt Close

Copy and save the link in order to return to this view