SwePub - search: L773:0014 5793 OR L773:1873 34...

Enumeration	Reference	Cover	Find
1.	Hägerhäll, Cecilia, et al. (author) A structural model for the membrane-integral domain of succinate:quinone oxidoreductases 1996 In: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. Journal article (peer-reviewed)abstract Many succinate:quinone oxidoreductases in bacteria and mitochondria, i.e, succinate:quinone reductases and fumarate reductases, contain in the membrane anchor a cytochrome b whose structure and function is poorly understood, Based on biochemical data and polypeptide sequence information, we show that the anchors in different organisms are related despite an apparent diversity in polypeptide and heme composition, A general structural model for the membrane-integral domain of the anchors is proposed, It is an antiparallel four-helix bundle with a novel arrangement of hexa-coordinated protoheme M. The structure can be applied to a larger group of membrane-integral cytochromes of b-type and has evolutionary and functional implications.
2.	Kim, Seog K., et al. (author) METHYL GREEN - A DNA MAJOR-GROOVE BINDING-DRUG 1993 In: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 315:1, s. 61-64 Journal article (peer-reviewed)abstract Interaction and binding geometries of complexes of Methyl green with poly(dA-dT)2, poly(dA) . poly(dT), and triplex poly(dA) . 2poly(dT) complexes have been studied by linear dichroism. For both of the complexes with double helical DNAs, the z symmetry axis of Methyl green is found to be approximately parallel to the DNA bases while the x symmetry axis lies at 40-44-degrees relative to the local DNA helix axis, in agreement with a groove binding mode. However, in contrast to minor-groove binders (such as DAPI and Hoechst 33258) Methyl green is found to be excluded from binding to the triple helical poly(dA) . 2poly(dT) in which the major groove is filled by the third strand. While most so far studied groove-binding dyes bind in the minor groove of DNA, Methyl green thus appears to be an exception.
3.	Rahn, Tova, et al. (author) Essential role of phosphatidylinositol 3-kinase in insulin-induced activation and phosphorylation of the cGMP-inhibited cAMP phosphodiesterase in rat adipocytes. Studies using the selective inhibitor wortmannin 1994 In: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 350:2-3, s. 314-318 Journal article (peer-reviewed)abstract Incubation of rat adipocytes with wortmannin, a potent and selective phosphatidylinositol 3-kinase (PI 3-kinase) inhibitor, completely blocked the antilipolytic action of insulin (IC50 = 100 nM), the insulin-induced activation and phosphorylation of cGMP-inhibited cAMP phosphodiesterase (cGI-PDE) as well as the activation of the insulin-stimulated cGI-PDE kinase (IC50 = 10-30 nM). No direct effects of the inhibitor on the insulin-stimulated cGI-PDE kinase, the cGI-PDE and the hormone-sensitive lipase were observed. These data suggest that activation of PI 3-kinase upstream of the insulin-stimulated cGI-PDE kinase in the antilipolytic insulin signalchain has an essential role for insulin-induced cGI-PDE activation/phosphorylation and anti-lipolysis.
4.	Smirnova, Irina A., et al. (author) HOQNO interaction with cytochrome b in succinate:menaquinone reductase from Bacillus subtilis 1995 In: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 359:1, s. 23-26 Journal article (peer-reviewed)abstract 2-n-Heptyl4-hydroxyquinoline-N-oxide (HOQNO) inhibits the succinate:quinone oxidoreductase activity of isolated and membrane-bound succinate:menaquinone oxidoreductase of B. subtilis. The inhibition pattern resembles closely that observed for α-thenoyltrifluoroacetone and carboxins in the mitochondrial succinate:ubiquinone oxidoreductase: ca. 90% of the activity is highly sensitive to HOQNO (K i ca. 0.2 μM for the isolated enzyme) whereas the rest 10% proves to be resistant to the inhibitor. HOQNO binding is shown to perturb the absorption spectrum of the ferrous di-heme cytochrome b of the B. subtilis succinate:quinone oxidoreductase both in the α and Soret bands. In addition, the inhibitor is shown to bring about a negative shift of E m of the low-potential heme b. It is suggested that HOQNO interacts with a menasemiquinone binding site near the low-potential heme and suppresses the MQ.−-to-MQH2 step of the quinone reductase reaction but allows partly for the MQ-to-MQ.− transition to occur; dismutation of MQ. formed in the latter reaction to MQ and MQH2 may account for the 10% of the enzyme activity insensitive to HOQNO.
5.	Takahashi, Masayuki, 1949, et al. (author) STRUCTURE OF UVRABC EXCINUCLEASE UV-DAMAGED DNA COMPLEXES STUDIED BY FLOW LINEAR DICHROISM - DNA CURVED BY UVRB AND UVRC 1992 In: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 314:1, s. 10-12 Journal article (peer-reviewed)abstract The interaction between UvrABC excinuclease from Escherichia coli and ultraviolet light- (UV) damaged DNA was studied by flow linear dichroism. The dichroism signal from DNA was drastically decreased in intensity upon incubation with UvrA and UvrB or whole enzyme in the presence of effector ATP. The change was specific for UV-damaged DNA, and a concluded suppressed DNA orientation suggests the wrapping of DNA around the protein. The incubation with the UvrC subunit alone also somewhat reduces the signal, however, in this case the change was smaller and not specific for UV-damaged DNA. The structural modification of DNA, promoted by the (UvrA2-UvrB) complex, probably facilitates or stabilizes the interaction of the UvrC subunit with DNA for the excision.
6.	Selmane, T., et al. (author) The L2 Loop Peptide of recA Stiffens and restricts Base Motions of Single-stranded DNA Similar to Intact Protein 1999 In: FEBS Letters. - 1873-3468 .- 0014-5793. ; 446:1, s. 30-34 Journal article (peer-reviewed)abstract The L2 loop in the RecA protein is the catalytic center for DNA strand exchange, Here we investigate the DMA binding properties of the L2 loop peptide using optical spectroscopy with polarized light. Both fluorescence intensity and anisotropy of an etheno-modified poly(dA) increase upon peptide binding, indicate that the base motions of single-stranded DNA are restricted in the complex. In agreement with this conclusion, the peptide-poly(dT) complex exhibits a significant linear dichroism signal. The peptide is also found to modify the structure of double-stranded DNA, but does not denature it. It is inferred that strand separation may not be required for the formation of a joint molecule.
7.	Stenson, Lena, et al. (author) Localization of hormone-sensitive lipase to rat Sertoli cells and its expression in developing and degenerating testes 1994 In: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 355:2, s. 125-130 Journal article (peer-reviewed)abstract Using in situ hybridization, hormone-sensitive lipase was found to be expressed in a stage-dependent manner in Sertoli cells of rat testis. No expression was found in Leydig cells but expression in spermatids could not be excluded. These results suggest a role for hormone-sensitive lipase in the metabolism of lipid droplets in Sertoli cells, in contrast to its previously proposed function in steroid biosynthesis. The expression of testicular hormone-sensitive lipase mRNA and protein, both larger in size compared to other tissues, coincided with the onset of spermatogenesis and was dependent on scrotal localization of the testis, suggesting a temperature-dependent, pretranslational regulation of expression.
8.	Wittung, Pernilla, 1968, et al. (author) Fluorescence-detected interactions of oligonucleotides in RecA complexes 1995 In: FEBS Letters. - 1873-3468 .- 0014-5793. ; 368:1, s. 64-68 Journal article (peer-reviewed)abstract A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA, The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible, The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed, In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur.
9.	Wittung, Pernilla, 1968, et al. (author) Phospholipid membrane permeability of peptide nucleic acid 1995 In: FEBS Letters. - : Wiley. - 1873-3468 .- 0014-5793. ; 365:1, s. 27-29 Journal article (peer-reviewed)abstract Phospholipid vesicles (liposomes) as membrane models have been used to study the penetration properties of peptide nucleic acid (PNA), a new DNA analog in which the nucleobases are attached to a pseudo-peptide backbone, The liposomes were characterised by carboxyfluorescein efflux, light-scattering and cryogenic transmission electron microscopy. The liposome structure was found not to be affected by the incorporation of PNA or an oligonucleotide. Two 10-mer fluorescein-labelled PNAs were found to have low efflux rates (half-times of 5.5 and 11 days), comparable to a 10-mer oligonucleotide (half-time of 7 days). We conclude that passive diffusion of unmodified PNA is not an effective way of transport into biological cells.
10.	Abdulkarim, Farhad, et al. (author) Mutations to kirromycin resistance occur in the interface of domains I and III of EF-Tu.GTP 1994 In: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 352, s. 118-122 Journal article (peer-reviewed)abstract The antibiotic kirromycin inhibits protein synthesis by binding to EF-Tu and preventing its release from the ribosome after GTP hydrolysis.We have isolated and sequenced a collection of kirromycin resistant tuf mutations and identified thirteen single amino acid substitutions at sevendifferent sites in EF-Tu. These have been mapped onto the 3D structures of EF-Tu’GTP and EF-Tu.GDP. In the active GTP form of EF-Tu themutations cluster on each side of the interface between domains I and III. We propose that this domain interface is the binding site for kirromycin.
11.	Bläckberg, Lars, et al. (author) Bile salt-stimulated lipase in human milk. Evidence that bile salt induces lipid binding and activation via binding to different sites. 1993 In: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 323:3, s. 207-210 Journal article (peer-reviewed)abstract Human milk bile salt-stimulated lipase ensures efficient triacylglycerol utilization in breast-fed newborns. For activity against long-chain triacylglycerol, primary bile salts are a prerequisite. Bile salts also protect the enzyme from inactivation by intestinal proteases. We have studied the effect of different bile salts on activation, protease protection, lipid binding, and enzyme inactivation, caused by an arginine modifying agent. Based on the results we propose a model involving two bile salt binding sites; one activation-site specific for primary bile salt, and another, less specific, lipid binding promoting site at which also secondary bile salt binds. Binding to this latter site induces binding of enzyme to emulsified substrates but binding promoting site at which also secondary bile salt binds. Binding to this latter site induces binding of enzyme to emulsified substrates but without subsequent lipolysis.
12.	Gavel, Ylva, et al. (author) A conserved cleavage-site motif in chloroplast transit peptides 1990 In: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 261:2, s. 455-458 Journal article (peer-reviewed)abstract A collection of 32 stroma-targeting chloroplast transit peptides with known cleavage sites have been analysed in terms of amino acid preferences in the vicinity of the processing site. A loosely conserved consensus motif (Val/Ile)-X-(Ala/Cys)↓Ala is found in the majority of the transit peptides. About 30% of the sequences have a perfect match to the consensus. When such a match is found, there is a 90% probability that it specifies the correct cleavage site.
13.	Islam, M. Shahidul, et al. (author) Ca(2+)-induced Ca2+ release in insulin-secreting cells 1992 In: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 296:3, s. 287-291 Journal article (peer-reviewed)abstract The sulphydryl reagent thimerosal (50 microM) released Ca2+ from a non-mitochondrial intracellular Ca2+ pool in a dose-dependent manner in permeabilized insulin-secreting RINm5F cells. This release was reversed after addition of the reducing agent dithiothreitol. Ca2+ was released from an Ins(1,4,5)P3-insensitive pool, since release was observed even after depletion of the Ins(1,4,5)P3-sensitive pool by a supramaximal dose of Ins(2,4,5)P3 or thapsigargin. The Ins(1,4,5)P3-sensitive pool remained essentially unaltered by thimerosal. Thimerosal-induced Ca2+ release was potentiated by caffeine. These findings suggest the existence of Ca(2+)-induced Ca2+ release also in insulin-secreting cells.
14.	Padilla, C. A., et al. (author) High-level expression of fully active human glutaredoxin (thioltransferase) in E. coli and characterization of Cys7 to Ser mutant protein 1996 In: FEBS Letters. - : Elsevier. - 0014-5793 .- 1873-3468. ; 378:1, s. 69-73 Journal article (peer-reviewed)abstract Glutaredoxin (Grx) (12 kDa) is a hydrogen donor for ribonucleotide reductase and also a general GSH-disulfide reductase of importance for redox regulation. To overexpress human glutaredoxin in Escherichia coli, a cDNA encoding human Grx was modified and cloned into the vector pET-3d and expressed in E. coli BL21 (DE3) by IPTG induction. High-level expression of Grx was verified by GSH-disulfide oxidoreductase activity, SDS-PAGE and immunoblotting analysis. The recombinant human Grx in its reduced form was purified to homogenity with 50% yield and exhibited the same dehydroascorbate reductase and hydrogen donor activity for ribonucleotide reductase (Km approximately 0.2 microM) as the human placenta protein. Human Grx contains a total of 5 half-cystine residues including a non-conserved Cys7 residue and is easily oxidized to form dimers during storage. A Grx mutant Cys7 to Ser was generated by site-directed mutagenesis and the protein was purified to homogeneity. The mutant protein showed full activity and exhibited a much reduced tendency to form dimers compared with the wild type protein. Peptide sequencing confirmed the mutation and removal of the N-terminal Met residue in both wild type and mutant proteins. Fluorescence spectra demonstrated only tyrosine fluorescence in human Grx with a peak at 310 nm which increased 20% upon reduction and decreased by addition of GSSG demonstrating that glutathione-containing disulfides are excellent substrates.
15.	RAICES, M, et al. (author) Cloning and characterization of a cDNA encoding a cellobiose dehydrogenase from the white rot fungus Phanerochaete chrysosporium 1995 In: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 369:2-3, s. 233-238 Journal article (peer-reviewed)abstract The cDNA of cellobiose dehydrogenase (CDH) from Phanerochaete chrysosporium has been cloned and sequenced. The 5′ end was obtained by PCR amplification. The cDNA contains 2310 translated bases excluding the poly(A) tail. The deduced mature protein contains 770 amino acid residues and is preceded by a 18 residue long signal peptide. The regions of the amino acid sequence corresponding to the heme and FAD domains of CDH were identified as well as the nucleotide-binding motif, the disulfide pairing and a methionine residue chelating the heme iron. No homologous sequences were found for the heme domain, however, the FAD domain appears to be distantly related to the GMC oxidoreductase family.
16.	Röhrig, Ursula, et al. (author) Coactosin interferes with the capping of actin filaments 1995 In: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 374:2, s. 284-286 Journal article (peer-reviewed)abstract Coactosin, a 16 kDa protein associated with the actin cytoskeleton from Dictyostelium discoideum, was purified by an improved method, in which other components of the cytoskeleton were removed. The highly purified coactosin had no effect on the time course of actin polymerization, but when added to actin in presence of capping proteins, coactosin counteracted the capping activity of these proteins. The capping proteins cap32/34 and severin domain 1 retarded actin polymerization, on addition of coactosin to samples containing one of these capping proteins the time course of actin polymerization became close to controls without capping proteins.
17.	Abdulkarim, Farhad, et al. (author) Mutants of EF-Tu defective in binding aminoacyl-tRNA 1996 In: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 382:3, s. 297-303 Journal article (peer-reviewed)abstract Five single amino acid substitution variants of EF-Tu from Salmonella typhimurium were tested for their ability to promote poly(U)-translation in vitro. The substitutions are Leu120Gln, Gln124Arg and Tyr160 (Asp or Asn or Cys). They were selected by their kirromycin resistant phenotypes and all substitutions are in domain I at the interface between domains I and III of the EF-Tu · GTP configuration. The different EF-Tu variants exhibit a spectrum of phenotypes. First, k(cat)/K(M) for the interaction between ternary complex and the programmed ribosome is apparently reduced by the substitutions Leu120Gln, Gln124Arg and Tyr160Cys. Second, this reduction is caused by a defect in the interaction between these EF-Tu variants and aminoacyl-tRNA during translation. Third, in four cases out of five the affinity of the complex between EF-Tu · GTP and aminoacyl-tRNA is significantly decreased. The most drastic reduction is observed for the Gln124Arg change, where the association constant is 30-fold lower than in the mild-type case. Fourth, missense errors are increased as well as decreased by the different amino acid substitutions. Finally, the dissociation rate constant (k(d)) for the release of GDP from EF-Tu is increased 6-fold by the Tyr160Cys substitution, but remains unchanged in the four other cases. These results show that the formation of ternary complex is sensitive to many different alterations in the domain I-III interface of EF-Tu.
18.	Aronsson, Göran, et al. (author) Remarkably slow folding of a small protein. 1997 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 411:2-3, s. 359-364 Journal article (peer-reviewed)abstract Equilibrium denaturation of the 72 amino acid alpha/beta-protein MerP, by acid, guanidine hydrochloride, or temperature, is fully reversible and follows a two-state model in which only the native and unfolded states are populated. A cis-trans equilibrium around a proline peptide bond causes a heterogeneity of the unfolded state and gives rise to a slow- and a fast folding population. With a rate constant of 1.2 s(-1) for the major fast folding population, which has none of the common intrinsically slow steps, MerP is the slowest folding protein of this small size yet reported.
19.	Basu, Samar, et al. (author) Oxidative injury and survival during endotoxemia 1998 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 438:3, s. 159-160 Journal article (peer-reviewed)abstract This study investigates the plasma levels of 8-iso-PGF2alpha, a non-enzymatic, and 15-K-DH-PGF2alpha, a cyclooxygenase catalyzed oxidation product of arachidonic acid in an experimental porcine endotoxemic shock model. A significant (P < 0.001) and rapid appearance and disappearance of PGF2alpha metabolite after endotoxin infusion was very similar in both non-survival and survival groups indicating an acute progression and recession of inflammation. When oxidative injury was assessed by measuring free 8-iso-PGF2alpha the levels in plasma increased significantly up to 2 h and remained at this level until death among the non-survivors. This was apparently different from the survivors where the 8-iso-PGF2alpha levels increased to its height at 1 h, then decreased to the basal levels after 5 h. Thus, free radical and cyclooxygenase catalyzed oxidation of arachidonic acid occurs during endotoxemia. Free radical dependent oxidative injury following endotoxin induced inflammation may be the major cause of organ failure and increased mortality.
20.	Feierberg, Isabella, et al. (author) Energetics of the proposed rate-determining step of the glyoxalase I reaction 1999 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 453:1-2, s. 90-94 Journal article (peer-reviewed)abstract The proposed rate-limiting step of the reaction catalyzed by glyoxalase I is the proton abstraction from the C1 carbon atom of the substrate by a glutamate residue, resulting in a high-energy enolate intermediate. This proton transfer reaction was modelled using molecular dynamics and free energy perturbation simulations, with the empirical valence bond method describing the potential energy surface of the system. The calculated rate constant for the reaction is approximately 300-1500 s(-1) with Zn2+, Mg2+ or Ca2+ bound to the active site, which agrees well with observed kinetics of the enzyme. Furthermore, the results imply that the origin of the catalytic rate enhancement is mainly associated with enolate stabilization by the metal ion.
21.	Ferrari, D., et al. (author) P2Z purinoreceptor ligation induces activation of caspases with distinct roles in apoptotic and necrotic alterations of cell death 1999 In: FEBS Letters. - : Elsevier. - 0014-5793 .- 1873-3468. ; 447:1, s. 71-75 Journal article (peer-reviewed)abstract Myeloic cells express a peculiar surface receptor for extracellular ATP, called the P2Z/P2X(7) purinoreceptor, which is involved in cell death signalling. Here, we investigated the role of caspases, a family of proteases implicated in apoptosis and the cytokine secretion. We observed that extracellular ATP induced the activation of multiple caspases including caspase-1, -3 and -8, and subsequent cleavage of the caspase substrates PARP and Iamin B. Using caspase inhibitors, it was found that caspases were specifically involved in ATP-induced apoptotic damage such as chromatin condensation and DNA fragmentation, In contrast, inhibition of caspases only marginally affected necrotic alterations and cell death proceeded normally whether or not nuclear damage was blocked. Our results therefore suggest that the activation of caspases by the P2Z receptor is required for apoptotic but not necrotic alterations of ATP-induced cell death. (C) 1999 Federation of European Biochemical Societies.
22.	Glaser, Elzbieta, et al. (author) Bifunctional role of the bc1 complex in plants Mitochondrial bc1 complex catalyses both electron transport and protein processing 1994 In: FEBS Letters. - : Wiley. - 0014-5793 .- 1873-3468. ; 346:1, s. 83-87 Journal article (peer-reviewed)abstract Abstract Nuclear encoded mitochondrial precursor proteins are cleaved to mature size products by the general mitochondrial processing peptidase (MPP). In contrast to non-plant sources where MPP is a matrix enzyme, the plant mitochondrial MPP is localised in the inner membrane and constitutes an integral part of the bc, complex of the respiratory chain. Core proteins of the complex are immunologically related and show high sequence similarity to the MPP subunits from non-plant sources. The bc, complex in plants is thus bifunctional, being involved both in respiration and in protein processing
23.	Grünler, J, et al. (author) Subcellular distribution of farnesyl protein transferase in rat liver 1999 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 455:3, s. 233-237 Journal article (peer-reviewed)abstract Farnesyl protein transferase (FPT) activity was measured in rat liver subcellular fractions by using an unspecific acceptor for the farnesyl groups. The highest specific activity was found in mitochondria and it exceeded that of the microsomes three-fold. Considerably lower specific activities were found in the nuclei and cytosol. Further subfractionation revealed that the mitochondrial FPT activity is located in the matrix. The beta-subunit of the mitochondrial enzyme has an apparent molecular mass of 46 kDa, which is similar to its cytosolic counterpart. The results suggest that protein farnesylation can take place in a number of subcellular organelles.
24.	Hober, Sophia, et al. (author) Insulin-like growth factors I and II are unable to form and maintain their native disulfides under in vivo redox conditions. 1999 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 443:3 Journal article (peer-reviewed)abstract Insulin-like growth factor (IGF) I does not quantitatively form its three native disulfide bonds in the presence of 10 mM reduced and 1 mM oxidized glutathione in vitro [Hober, S. et al. (1992) Biochemistry 31, 1749-1756]. In this paper, we show (i) that both IGF-I and IGF-II are unable to form and maintain their native disulfide bonds at redox conditions that are similar to the situation in the secretory vesicles in vivo and (ii) that the presence of protein disulfide isomerase does not overcome this problem. The results indicate that the previously described thermodynamic disulfide exchange folding problem of IGF-I in vitro is also present in vivo. Speculatively, we suggest that the thermodynamic disulfide exchange properties of IGF-I and II are biologically significant for inactivation of the unbound growth factors by disulfide exchange reactions to generate variants destined for rapid clearance.
25.	Hughes, Kate, et al. (author) Calmodulin dependence of NFκB activation 1998 In: FEBS Letters. - : Elsevier. - 0014-5793 .- 1873-3468. ; 441:1, s. 132-136 Journal article (peer-reviewed)abstract The NF kappa B family of transcription factors is regulated by inhibitory I kappa B proteins. A diversity of stimuli leads to the phosphorylation and subsequent degradation of I kappa B, releasing NF kappa B to act on its target genes. Calmodulin (CaM) is a key regulator of numerous cellular processes and is the predominant intracellular receptor for Ca2+ signals. Here me report that several CaM antagonists inhibit the activation of NF kappa B, and that this is due to the prevention of inducible I kappa B phosphorylation. Our results suggest that CaM is involved in the phosphorylation of I kappa B, a finding that may help in elucidating the mechanism of this critical step of NF kappa B activation.
26.	Igamberdiev, Abir U, et al. (author) Involvement of cyanide-resistant and rotenone-insensitive pathways of mitochondrial electron transport during oxidation of glycine in higher plants 1997 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 412:2, s. 265-269 Journal article (peer-reviewed)abstract Metabolism of glycine in isolated mitochondria and protoplasts was investigated in photosynthetic, etiolated (barley and pea leaves) and fat-storing (maize scutellum) tissues using methods of [1-C-14]glycine incorporation and counting of (CO2)-C-14 evolved, oxymetric measurement of glycine oxidation and rapid fractionation of protoplasts incubated in photorespiratory conditions with consequent determination of ATP/ADP ratios in different cell compartments, The involvement of different paths of electron transport in mitochondria during operation of glycine decarboxylase complex (GDC) was tested in different conditions, using aminoacetonitrile (AAN), the inhibitor of glycine oxidation in mitochondria, rotenone, the inhibitor of Complex I of mitochondrial electron transport, and inhibitors of cytochrome oxidase and alternative oxidase, It was shown that glycine has a preference to other substrates oxidized in mitochondria only in photosynthetic tissue where succinate and malate even stimulated its oxidation, Rotenone had no or small effect on glycine oxidation, whereas the role of cyanide-resistant path increased in the presence of ATP, Glycine oxidation increased ATP/ADP ratio in cytosol of barley protoplasts incubated in the presence of CO2, but not in the CO2-free medium indicating that in conditions of high photorespiratory nus oxidation of NADH formed in the GDC reaction passes via the non-coupled paths, Activity of GDC in fat-storing tissue correlated with the activity of glyoxylate-cycle enzymes, glycine oxidation did not reveal preference to other substrates and the involvement of paths non-connected with proton translocation was not pronounced, It is suggested that the preference of glycine to other substrates oxidized in mitochondria is achieved in photosynthetic tissue by switching to rotenone-insensitive intramitochrondrial NADH oxidation and by increasing of alternative oxidase involvement in the presence of glycine. (C) 1997 Federation of European Biochemical Societies.
27.	Islam, M. Shahidul, et al. (author) Interaction with the inositol 1,4,5-trisphosphate receptor promotes Ca2+ sequestration in permeabilised insulin-secreting cells 1991 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 288:1-2, s. 27-29 Journal article (peer-reviewed)abstract Electropermeabilised insulin-secreting RINm5F cells sequestered Ca2+, resulting in a steady-state level of the ambient free Ca2+ concentration corresponding to 723 +/- 127 nM (mean +/- SEM, n = 10), as monitored by a Ca(2+)-selective minielectrode. Inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) promoted a rapid and pronounced release of Ca2+. This Ca2+ was resequestered and a new steady-state Ca2+ level was attained, which was always lower (460 +/- 102 nM, n = 10, P less than 0.001) than the steady-state Ca2+ level maintained before the addition of Ins(1,4,5)P3. Whereas the initial reuptake of Ca2+ subsequent to Ins(1,4,5)P3 stimulation was relatively slow, the later part of reuptake was fast as compared to the reuptake phases of a pulse addition of extraneous Ca2+. In the latter case the uptake of Ca2+ resulted in a steady-state level similar to that found in the absence of Ins(1,4,5)P3. Addition of Ins(1,4,5)P3 under this condition resulted in a further Ca2+ uptake and thus a lower steady-state Ca2+ level. Heparin, which binds to the Ins(1,4,5)P3 receptor, also lowered the steady-state free Ca2+ concentration. In contrast to Ins(1,4,5)P3, inositol 1,3,4,5-tetrakisphosphate was without effect on Ca2+ sequestration. These findings are consistent with the presence of a high-affinity Ins(1,4,5)P3 receptor promoting continuous release of Ca2+ under basal conditions and/or the Ins(1,4,5)P3 receptor being actively involved in Ca2+ sequestration.
28.	Jansson, Magnus, et al. (author) Binding affinities of insulin-like growth factor-I (IGF-I) fusion proteins to IGF binding protein 1 and IGF-I receptor are not correlated with mitogenic activity. 1997 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 416:3, s. 259-264 Journal article (peer-reviewed)abstract In this report, comparisons between molecular affinities and cellular proliferation activities have been made for insulin-like growth factor-I (IGF-I) and two IGF-I fusion proteins in order to evaluate fusion proteins as tools for receptor binding studies. Binding affinities and growth promoting effects of the N-terminal fusion Z-IGF-I and the C-terminal fusion IGF-I-Z, and native recombinant human IGF-I, were analyzed. Binding kinetic properties of the three IGF-I variants were analyzed using BIAcore kinetic interaction analysis testing for binding to both human IGF binding protein 1 (IGFBP-1) and a soluble form of the human IGF type I receptor extracellular domains (sIGF-IR). The growth promoting effects on SaOS-2 human osteosarcoma cells of the different fusion proteins were analyzed. A comparison of receptor binding affinities and growth promoting effects shows that the fusion protein receptor affinity does not correlate with proliferative potential. The IGF-I-Z fusion, with the lowest receptor affinity, shows similar proliferative potential to native IGF-I. However, the Z-IGF-I fusion protein, with twice the receptor affinity of IGF-I-Z, displays only about 70% of the IGF-I-Z growth promoting activity. Both IGF-I fusion proteins possess similar affinity to IGFBP-1. These results indicate that determinants other than the receptor affinity could be involved in the regulation of IGF-I proliferative action. This study demonstrates that ligand fusion proteins may be useful to study mechanisms of ligand induced receptor activation.
29.	Jönsson, L., et al. (author) Stereospecificity in enzymic and non-enzymic oxidation of β-O-4 lignin model compounds 1990 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 276:1,2, s. 45-48 Journal article (peer-reviewed)
30.	Lu, G, et al. (author) Novel tetramer assembly of pyruvate decarboxylase from brewer's yeast observed in a new crystal form 1997 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 403:3, s. 249-253 Journal article (peer-reviewed)abstract A new crystal form of thiamine diphosphate dependent pyruvate decarboxylase from Saccharomyces cerevisiae has been obtained in the presence of the activator pyruvamide. The crystallographic structure analysis reveals differences in the domain packing in the enzyme subunit and a novel assembly of the subunits in the tetramer, when compared to the structure of native PDC. The orientation of the beta domains in the subunit differs by a 6.3 degrees and 8.3 degrees rotation, respectively, whereas the subunit-subunit interface in the dimer, formed by the alpha and gamma domains, is essentially maintained. In the tetramer, one of the dimers rotates relative to the second dimer by approximately 30 degrees creating a new dimer-dimer interface.
31.	Malmström, Susanna, et al. (author) A calmodulin-stimulated Ca2+-ATPase from plant vacuolar membranes with a putative regulatory domain at its N-terminus 1997 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 400:3, s. 324-328 Journal article (peer-reviewed)abstract A cDNA, BCA1, encoding a calmodulin-stimulated Ca2+-ATPase in the vacuolar membrane of cauliflower (Brassica oleracea) was isolated based on the sequence of tryptic peptides derived from the purified protein. The BCA1 cDNA shares sequence identity with animal plasma membrane Ca2+-ATPases and Arabidopsis thaliana ACA1, that encodes a putative Ca2+ pump in the chloroplast envelope. In contrast to the plasma membrane Ca2+-ATPases of animal cells, which have a calmodulin-binding domain situated in the carboxy-terminal end of the molecule, the calmodulin-binding domain of BCA1 is situated at the amino terminus of the enzyme.
32.	Mannervik, Mattias, et al. (author) The transcriptionalco-activator proteins p300 and CBP stimulate adenovirus E1A conservedregion 1 transactivation independent of a direct interaction 1997 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 414:1, s. 111-116 Journal article (peer-reviewed)abstract p300 and CBP are two related transcriptional co-activator proteins required by many cellular transcription factors for activity. The adenovirus E1A protein binds p300 and CBP through its amino-terminus and conserved region (CR) 1. Fusing CR1 to a heterologous DNA-binding domain creates a potent transcriptional activator, suggesting that CR1 might activate transcription by recruiting p300/CBP to the promoter. We show that both p300 and CBP enhances CR1-dependent transactivation. However, this enhancement occurs independently of a direct interaction with E1A and does not correlate with the CR1 activator function.
33.	Messinger, Johannes, 1963-, et al. (author) THE REACTIVITY OF HYDRAZINE WITH PHOTOSYSTEM-II STRONGLY DEPENDS ON THE REDOX STATE OF THE WATER OXIDIZING SYSTEM 1990 In: FEBS Letters. - : ELSEVIER SCIENCE BV. - 0014-5793 .- 1873-3468. ; 277:1-2, s. 141-146 Journal article (peer-reviewed)abstract The decay kinetics of the redox states S2 and S3 of the water-oxidizing enzyme have been analyzed in isolated spinach thylakoids in the absence and presence of the exogenous reductant hydrazine. In control samples without NH2NH2 a biphasic decay is observed. The rapid decline of S2 and S3 with Y(D) as reductant exhibits practically the same kinetics with t1/2 = 6-7 s at pH = 7.2 and 7-degrees-C. The slow reduction (order of 5-10 min at 7-degrees-C) of S2 and S3 with endogenous electron donors other than Y(D) is about twice as fast for S2 as for S3 under these conditions. In contrast, the hydrazine-induced reductive shifts of the formal redox states S(i) (i = 0 ... 3) are characterized by a totally different kinetic pattern: (a) at 1 mM NH2NH2 and incubation on ice the decay of S2 is estimated to be at least 25 times faster (t1/2 less-than-or-equal-to 0.4 min) than the corresponding reaction of S3 (t1/2 almost-equal-to 13 min); (b) the NH2NH2-induced decay of S3 is even slower (about twice) than the transformation of S1 into the formal redox state 'S-1' (t1/2 almost-equal-to 6 min), which gives rise to the two-digit phase shift of the oxygen-yield pattern induced by a flash train in dark adapted thylakoids. (c) the NH2NH2-induced transformation S0-->'S-2' [Renger, Messinger and Hanssum (1990) in: Curr. Res. Photosynth. (Baltscheffsky, M., ed) Vol. 1, pp. 845-848, Kluwer, Dordrecht] is about three times faster (t1/2 almost-equal-to 2 min) than the reaction S1 [GRAPHICS] 'S-1'. Based on these results, the following dependence on the redox state S(i) of the reactivity towards NH2NH2 is obtained: S3 < S1 < S0 < < S2. The implications of this surprising order of reactivity are discussed.
34.	Nordstrand, K, et al. (author) Direct NMR observation of the Cys-14 thiol proton of reduced Escherichia coli glutaredoxin-3 supports the presence of an active site thiol-thiolate hydrogen bond 1999 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 449:2-3, s. 196-200 Journal article (peer-reviewed)abstract The active site of Escherichia coli glutaredoxin-3 (Grx3) consists of two redox active cysteine residues in the sequence -C-11-P-Y-C-14-H-. The H-1 NMR resonance of the cysteine thiol proton of Cys-14 in reduced Grx3 is observed at 7.6 ppm. The large downfield shift and NOEs observed with this thiol proton resonance suggest the presence of a hydrogen bond with the Cvs-ll thiolate, which is shown to have an abnormally low pK(a) value. A hydrogen bond would also agree,vith activity data of Grx3 active site mutants. Furthermore, the activity is reduced in a Grx3 H15V mutant, indicating electrostatic contributions to the stabilization of the Cys-ll thiolate, (C) 1999 Federation of European Biochemical Societies.
35.	Oscarsson, Mikael, et al. (author) Genotyping of human cytochrome P450 2A6 (CYP2A6), a nicotine C-oxidase 1998 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 438:3, s. 201-205 Journal article (peer-reviewed)abstract Cytochrome P450 2A6 (CYP2A6) is a polymorphic enzyme responsible for the oxidation of certain precarcinogens and drugs and is the major nicotine C-oxidase. The role of CYP2A6 for nicotine elimination was emphasised recently by the finding that smokers carrying defective CYP2A6 alleles consumed fewer cigarettes [Pianezza et al. (1998) Nature 393, 750]. The method used for CYP2A6 genotyping has, however, been found to give erroneous results with respect to the coumarin hydroxylase phenotype, a probe reaction for the CYP2A6 enzyme. The present study describes an allele-specific PCR genotyping method that identifies the major defective CYP2A6 allele and accurately predicts the phenotype. An allele frequency of 1-3% was observed in Finnish, Spanish, and Swedish populations, much lower than described previously.
36.	Parmryd, Ingela, et al. (author) Chloroplastic prenylated proteins 1997 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 414:3, s. 527-531 Journal article (peer-reviewed)abstract By in vivo [3H]mevalonate labelling of spinach combined with biochemical analysis, evidence is provided for the existence of protein prenylation in chloroplasts. Approximately 20 prenylated polypeptides were resolved by SDS-PAGE followed by autoradiography. Thermolysin treatment of intact chloroplasts revealed that about 40% of the prenylated polypeptides were associated with the cytoplasmic surface of the outer envelope membrane. The remaining portion was present in thylakoids and/or the inner envelope membrane. The majority of the prenylated polypeptides were associated with larger membrane protein complexes. A farnesyl protein transferase activity was found to be associated with the thylakoid membrane.
37.	Paunio, T, et al. (author) Tissue distribution and levels of gelsolin mRNA in normal individuals and patients with gelsolin-related amyloidosis. 1997 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 406:1-2, s. 49-55 Journal article (peer-reviewed)abstract We measured quantitatively the mRNA levels of intracellular and secretory forms of gelsolin, an actin-modulating protein, in human tissues from subjects of different ages. The intracellular gelsolin mRNA constituted the major type of gelsolin steady-state mRNA in all tissues analyzed. Both forms of gelsolin were expressed in most adult tissues, with particularly high mRNA levels in all types of muscle and interestingly in skin. Between the adult and infantile tissues the most striking difference in expression levels was found in liver, as the adult liver contained only a subtle amount of gelsolin mRNA. Skin and muscle samples from patients with gelsolin-related amyloidosis (FAF), with significantly increased concentrations of serum gelsolin, did not reveal an increased expression of the gene, and both mutant and wild-type alleles were expressed in equal amounts. The high level of expression of the gelsolin gene in the skin in general could locally contribute to the characteristic skin amyloidosis in FAF patients.
38.	Spyrou, Giannis, et al. (author) AP-1 DNA-binding activity is inhibited by selenite and selenodiglutathione 1995 In: FEBS Letters. - : Elsevier. - 0014-5793 .- 1873-3468. ; 368:1, s. 59-63 Journal article (peer-reviewed)abstract The binding of the transcription factor AP-1 to DNA has been shown to be modulated by redox control mechanisms. Selenite and selenodiglutathione (GS-Se-SG), inhibit mammalian cell growth and are efficient oxidants of reduced thioredoxin and reduced thioredoxin reductase. Here, we report that selenite and GS-Se-SG efficiently inhibited AP-1 DNA-binding in nuclear extracts from 3B6 lymphocytes. A GS-Se-SG concentration of 0.75 microM resulted in 50% inhibition of AP-1 DNA-binding, whereas the same effect was achieved with 7.5 microM selenite. Nuclear extracts prepared from human 3B6 lymphocytes exposed for 4 h to 10 microM selenite showed a 50% reduction of AP-1 binding. These data suggest that selenite and selenodiglutathione inactivate the AP-1 factor and provide a mechanism by which selenium compounds inhibit cell growth.
39.	Stålberg, Peter, et al. (author) Suppression of the neoplastic phenotype by transfection of phospholipase C3 to neuroendocrine tumor cells 1999 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 450:3, s. 210-216 Journal article (peer-reviewed)abstract The expression of phospholipase C beta 3 (PLCB3) is low or absent in several neuroendocrine neoplasias. To investigate the role of PLCB3 in the neuroendocrine tumorigenesis, we transfected a PLCB3 construct to three neuroendocrine tumor cell lines with a low PLCB3 expression. The growth rate and tumorigenicity were assessed in vitro by [3H]thymidine incorporation and cell counting, in vivo, by xenografting to nude mice. In vitro, PLCB3 expressing clones showed a significant growth inhibition. The tumor weight was reduced for one of the two xenografted PLCB3-transfected cell lines and in both, a reduced number of proliferating (Ki-67 positive) cells was observed. This study implies an essential role for PLCB3 in the neuroendocrine tumorigenesis.
40.	Valerio, M, et al. (author) Tissue-specificity of the regulation of ATP hydrolysis by isolated plant-mitochondria 1993 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 318:2, s. 113-117 Journal article (peer-reviewed)abstract Pea leaf mitochondria had a high ATP hydrolase activity following the collapse of the membrane potential by addition of valinomycin in state 4. In mitochondria isolated from potato tubers such ATP hydrolase activity was not observed. Pea leaf mitochondria also had a DELTApH, in contrast to what was previously found for potato tuber mitochondria. This DELTApH could, however, not explain the different results on ATP hydrolysis since this activity was also observed in the presence of nigericin. The results suggest a tissue-specific regulation of ATP hydrolysis in resting organs (potato tubers) as compared to active organs (leaves).
41.	Wang, Shu, et al. (author) Targeted disruption of the mouse phospholipase C β3 gene results in early embryonic lethality 1998 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 441:2, s. 261-265 Journal article (other academic/artistic)abstract In order to investigate the biological function of phosphatidylinositol-specific phospholipase C (PLC) we generated mutant mice by gene targeting. Homozygous inactivation of PLCbeta3 is lethal at embryonic day 2.5. These mutants show poor embryonic organization as well as reduced numbers of cells. Identical phenotypes were recorded in homozygous mutants generated from two independently targeted embryonic stem cell clones. Heterozygous mutant mice, however, are viable and fertile for at least two generations. We also showed that mouse PLCbeta3 is expressed in unfertilized eggs, 3-cell and egg cylinder stages of embryos. In conclusion, these results indicate that PLCbeta3 expression is essential for early mouse embryonic development.
42.	Wang, She, et al. (author) Targeted disruption of the mouse PLC b3 gene results in defective preimplantation and tumor predisposition 1998 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 441:2, s. 261-265 Journal article (peer-reviewed)abstract In order to investigate the biological function of phosphatidylinositol-specific phospholipase C (PLC) we generated mutant mice by gene targeting. Homozygous inactivation of PLCβ3 is lethal at embryonic day 2.5. These mutants show poor embryonic organization as well as reduced numbers of cells. Identical phenotypes were recorded in homozygous mutants generated from two independently targeted embryonic stem cell clones. Heterozygous mutant mice, however, are viable and fertile for at least two generations. We also showed that mouse PLCβ3 is expressed in unfertilized eggs, 3-cell and egg cylinder stages of embryos. In conclusion, these results indicate that PLCβ3 expression is essential for early mouse embryonic development.
43.	Yue, Bai-Gong, et al. (author) A downstream splicing enhancer is essential for in vitro pre-mRNA splicing 1999 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 451:1, s. 10-14 Journal article (peer-reviewed)abstract Splicing enhancers have previously been shown to promote processing of introns containing weak splicing signals. Here, we extend these studies by showing that also 'strong' constitutively active introns are absolutely dependent on a downstream splicing enhancer for activity in vitro. SR protein binding to exonic enhancer elements or U1 snRNP binding to a downstream 5' splice site serve redundant functions as activators of splicing. We further show that a 5' splice site is most effective as an enhancer of splicing. Thus, a 5' splice site is functional in S100 extracts, under conditions where a SR enhancer is nonfunctional. Also, splice site pairing occurs efficiently in the absence of exonic SR enhancers, emphasizing the significance of a downstream 5' splice site as the enhancer element in vertebrate splicing.
44.	Bondeson, K, et al. (author) DNA binding of polyomavirus large T-antigen : kinetics of interactions with different types of binding sites. 1998 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 423:3, s. 307-13 Journal article (peer-reviewed)abstract Polyomavirus large T-antigen binds to GRGGC sites in double-stranded viral DNA, regulating transcription and replication. Using surface plasmon resonance to record interactions of large T-antigen with different types of binding sites, we found that the configuration of recognition motifs influenced both the association and dissociation rates. Particularly, the complex formed at the origin of DNA replication was labile. A comparison of the interactions between large T-antigen and binding sites with one, two and four GRGGC motifs in tandem showed a strong preference for dimer binding, without detectable co-operativity between dimers. Sodium chloride stabilised the complexes, whereas the dissociation increased rapidly by increasing pH above 7.0.
45.	Eriksson, A M, et al. (author) Is the cytosolic catalase induced by peroxisome proliferators in mouse liver on its way to the peroxisomes? 1992 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 308:2 Journal article (peer-reviewed)abstract Dietary treatment of male C57B1/6 mice with clofibrate, nafenopin or WY-14.643 resulted in a modest (at most 2-fold) increase in the total catalase activity in the whole homogenate and mitochondrial fraction prepared from the livers of these animals. On the other hand, the catalase activity recovered in the cytosolic fraction was increased 12- to 18-fold, i.e. 30-35% of the total catalase activity in the hepatic homogenate was present in the high-speed supernatant fraction after treatment with these peroxisome proliferators. A study of the time course of the changes in peroxisomal and cytosolic catalase activities demonstrated that the peroxisomal activity both increased upon initiation of exposure and decreased after termination of treatment several days after the increase and decrease, respectively, in the corresponding cytosolic activity. This finding suggests that the cytosolic catalase may be on its way to incorporation into peroxisomes.
46.	Hammarström, Per, 1972-, et al. (author) Pyrene Excimer Fluorescence as a Proximity Probe for Investigation of Residual Structure in the Unfolded State of Human Carbonic Anhydrase II 1997 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 420, s. 63-68 Journal article (peer-reviewed)
47.	Islam, M. Shahidul, et al. (author) Sulfhydryl oxidation induces rapid and reversible closure of the ATP-regulated K+ channel in the pancreatic beta-cell 1993 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 319:1-2, s. 128-132 Journal article (peer-reviewed)abstract Effects of sulfhydryl modification on the ATP regulated K+ channel (KATP channel) in the pancreatic beta-cell were studied, using the patch clamp technique. Application of the sulfhydryl oxidizing agents thimerosal and 2,2'-dithio-bis(5-nitropyridine) (DTBNP), in micromolar concentrations, caused complete inhibition of the KATP channel, in inside-out patches. The inhibition was rapid and was reversed by the disulfide reducing agents dithiothreitol and cysteine. Thimerosal, which is poorly membrane permeable, inhibited channel activity, only when applied to the intracellular face of the plasma membrane. In contrast, DTBNP, which is highly lipophilic, caused closure of the KATP channel and consequent depolarization of the membrane potential, also when applied extracellularly. Our results indicate the presence of accessible free SH groups on the cytoplasmic side of the KATP channel in the pancreatic beta-cell. These SH groups are essential for channel function and it is possible that thiol-dependent redox mechanisms can modulate KATP channel activity.
48.	Kleczkowski, Leszek A, 1954- (author) A phosphoglycerate to inorganic phosphate ratio is the major factor in controlling starch levels in chloroplasts via ADP-glucose pyrophosphorylase regulation 1999 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 448:1, s. 153-156 Journal article (peer-reviewed)abstract Purified barley leaf ADP-glucose pyrophosphorylase, a key enzyme of the starch synthesis in the chloroplast stroma, was analysed with respect to its possible regulation by factors defining the metabolic/effector status of the chloroplast during light and dark conditions. The enzyme required 3-phosphoglyceric acid for the maximal activity and was inhibited by inorganic phosphate. The optimal pH for the enzyme was at circa 7.0, regardless of the presence or absence of 3-phosphoglyceric acid, whereas the maximal activation by 3-phosphoglyceric acid was observed at pH 8.5 and higher. Changes in the concentration of Mg2+ and dithiothreitol had little or no effect on the enzymatic activity of AGPase. It has been directly demonstrated for the first time that a 3-phosphoglyceric acid/inorganic phosphate ratio, a crucial regulatory parameter, could be directly related to a defined activation state of the enzyme, allowing the prediction of a relative AGPase activity under given conditions. The predicted changes in the enzyme activity were directly correlated with earlier reported responses of starch levels to the 3-phosphoglyceric acid/inorganic phosphate ratio in chloroplasts. Consequences of this for the starch biosynthesis are discussed. (C) 1999 Federation of European Biochemical Societies.
49.	Lönnerdal, Bo, et al. (author) Cloning and sequencing of a cDNA encoding human milk beta-casein. 1990 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 269:1, s. 153-6 Journal article (peer-reviewed)abstract A cDNA of 1065 bp encoding the human milk beta-casein was cloned and sequenced using a synthetic oligodeoxyribonucleotide probe and a human mammary gland library. The nucleotide (nt) sequence contained an open reading frame sufficient to encode the entire amino-acid (aa) sequence of a beta-casein precursor protein consisting of 210 aa and a signal peptide of 15 aa. The nt sequence shows 45-62% homology to those of bovine, ovine, rat, and mouse beta-caseins. The highly phosphorylated site, which is responsible for the calcium-binding capacity of beta-casein, the signal peptide, and a sequence encoding for an inhibitor to the angiotensin-converting enzyme seem highly conserved among the beta-caseins with known sequences.
50.	Neuzil, J., et al. (author) Alfa-Tocopheryl-induced apoptosis in Jurkat T cells involves caspase-3 activation, and both mitochondrial and lysosomal destabilization. 1999 In: FEBS Letters. - 0014-5793 .- 1873-3468. ; 445, s. 295-300 Journal article (peer-reviewed)

Skapa referenser, mejla, bekava och länka

Permalink

Träfflista för sökning "L773:0014 5793 OR L773:1873 3468 ;srt2:(1990-1999)"

Refine your search

Year