| 1. |
- Blomberg, Stina, et al.
(author)
-
Expression of the markers BDCA-2 and BDCA-4 and production of interferon-alpha by plasmacytoid dendritic cells in systemic lupus erythematosus
- 2003
-
In: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 48:9, s. 2524-32
-
Journal article (peer-reviewed)abstract
- OBJECTIVE: To study the expression of blood dendritic cell antigen 2 (BDCA-2) and BDCA-4 molecules by plasmacytoid dendritic cells (PDCs) in the blood of patients with systemic lupus erythematosus (SLE), and to study PDC production of interferon-alpha (IFN alpha) and its inhibition by anti-BDCA-2 and anti-BDCA-4 antibodies. METHODS: Peripheral blood mononuclear cells (PBMCs) from SLE patients (SLE PBMCs) and from healthy controls were induced to produce IFN alpha in vitro by SLE serum containing an endogenous IFN alpha-inducing factor (SLE-IIF) or by herpes simplex virus type 1 (HSV-1). The frequencies and numbers of BDCA-2-, BDCA-3-, and BDCA-4-expressing cells were analyzed by flow cytometry, and the effects of anti-BDCA-2 and anti-BDCA-4 monoclonal antibodies (mAb) on IFN alpha production were investigated. RESULTS: IFN alpha production by SLE PBMCs induced by SLE-IIF or HSV-1 was decreased compared with that of healthy control PBMCs (P = 0.002 and P = 0.0007, respectively). The proportions of BDCA-2- and BDCA-3-expressing cells in SLE PBMCs were reduced compared with those in PBMCs from healthy controls (P = 0.01 and P = 0.004, respectively). IFN alpha producers in culture, especially among SLE PBMCs, displayed reduced BDCA-2 expression and constituted only a minority of the BDCA-2-positive cells, at least in healthy control PBMCs (median 18%). IFN alpha production by both SLE and healthy control PBMCs stimulated by SLE-IIF or HSV-1 was markedly reduced by anti-BDCA-2 mAb (median 81-98% inhibition). Anti-BDCA-4 mAb only partially inhibited SLE-IIF-induced IFN alpha production. CONCLUSION: SLE patients had a reduced number of BDCA-2-expressing PDCs, also termed natural IFN alpha-producing cells, and their IFN alpha production could be inhibited by anti-BDCA-2/4 mAb. Such mAb may be a therapeutic option for inhibiting the ongoing IFN alpha production in SLE patients.
|
|
| 2. |
- Blomberg, Stina, et al.
(author)
-
Presence of cutaneous interferon-alpha producing cells in patients with systemic lupus erythematosus
- 2001
-
In: Lupus. - : SAGE Publications. - 0961-2033 .- 1477-0962. ; 10:7, s. 484-90
-
Journal article (peer-reviewed)abstract
- Systemic lupus erythematosus (SLE) patients have increased levels of interferon-alfa (IFN-alpha) in the circulation but a reduced number of functionally intact natural IFN-alpha producing cells (IPC) in peripheral blood. In search for tissue localisation of activated IPC, we investigated skin biopsies from SLE patients for the occurrence of such cells. Eleven SLE patients with inflammatory skin lesions and six healthy controls were biopsied. An immunohistochemical technique (IH) and in situ hybridisation (ISH) were used to detect intracellular IFN-alpha protein and IFN-alpha mRNA, respectively. In all 11 biopsies from SLE lesions, a high number of IPC were detected by IH. In the nonlesional SLE biopsies we could also demonstrate IPC in 10/11 patients. In 6/11 SLE patients, IFN-alpha mRNA containing cells could be detected in the specimens. A low number of IPC were detected in 1/6 healthy controls by IH, but no ISH positive cells were seen. Our results demonstrate that SLE patients have active IPC in both dermal lesions and in noninflammatory skin. A recruitment of IPC from blood to peripheral tissues may explain the low number of circulating natural IPC in SLE patients. Because the type I IFN system is involved in the SLE disease process, these results are of interest for the understanding of the pathogenesis in SLE.
|
|
| 3. |
- Båve, Ullvi, et al.
(author)
-
Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG
- 2003
-
In: Journal of Immunology. - : American Association of Immunologists. - 0022-1767 .- 1550-6606. ; 171:6, s. 3296-302
-
Journal article (peer-reviewed)abstract
- An ongoing production of IFN-alpha may be of etiopathogenic significance in systemic lupus erythematosus (SLE). It may be due to the natural IFN-producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), activated by immune complexes that contain nucleic acids derived from apoptotic cells. We here examined the role of FcgammaR in the IFN-alpha production in vitro by PBMC induced by the combination of apoptotic U937 cells and autoantibody-containing IgG from SLE patients (SLE-IgG). The Fc portion of the SLE-IgG was essential to induce IFN-alpha production, because Fab fragments or F(ab')(2) were ineffective. Normal, especially heat-aggregated, IgG inhibited the IFN-alpha production, suggesting a role for FcgammaR on PBMC. Using blocking anti-FcgammaR Abs, the FcgammaRIIa,c (CD32) but not FcgammaRI or FcgammaRIII were shown to be involved in the IFN-alpha induction by apoptotic cells combined with SLE-IgG, but not by HSV or CpG DNA. In contrast, the action of all of these inducers was inhibited by the anti-FcgammaRIIa,b,c mAb AT10 or heat-aggregated IgG. Flow cytometric analysis revealed that approximately 50% of the BDCA-2-positive PBMC, i.e., NIPC/PDC, expressed low but significant levels of FcgammaRII, as did most of the actual IFN-alpha producers activated by HSV. RT-PCR applied to NIPC/PDC purified by FACS demonstrated expression of FcgammaRIIa, but not of FcgammaRIIb or FcgammaRIIc. We conclude that FcgammaRIIa on NIPC/PDC is involved in the activation of IFN-alpha production by interferogenic immune complexes, but may also mediate inhibitory signals. The FcgammaRIIa could therefore have a key function in NIPC/PDC and be a potential therapeutic target in SLE.
|
|
| 4. |
- Domeika, Kristina, et al.
(author)
-
Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
- 2004
-
In: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 101:1-2, s. 87-102
-
Journal article (peer-reviewed)abstract
- The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.
|
|
| 5. |
- Funseth, Eva, et al.
(author)
-
Effects of coxsackievirus B3 infection on the acute-phase protein metallothionein and on cytochrome P-4501A1 involved in the detoxification processes of TCDD in the mouse
- 2002
-
In: Science of the Total Environment. - 0048-9697 .- 1879-1026. ; 284:1-3, s. 37-47
-
Journal article (peer-reviewed)abstract
- During acute infections, the synthesis of acute-phase proteins and other proteins participating in the host defence are stimulated in the liver and kidney. In previous studies of coxsackievirus B3 (CB3) infection in mice, we found that cadmium (Cd) accumulates in the kidney, whereas 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) accumulates in the liver. To study if CB3 infection affects the synthesis of the Cd-binding protein metallothionein (MT) and the TCDD-binding/detoxifying cytochrome P-450 (CYP-450) isozyme CYP1A1, the basal and TCDD-induced levels of serum MT and liver CYP1A1 isozyme were determined in healthy and CB3-infected A/J mice. Furthermore, because interferons affect CYP450 activity, the serum levels of the interferons alpha (IFN-alpha) and -beta (IFN-beta) were measured in CB3-infected mice and in mice treated with the interferon-inducer polyinosinic/polycytidylic acid (poly I/C). Virus or poly I/C was administered intraperitoneally (i.p.) on day 0 and 500 ng TCDD/kg bodyweight on day 1. On day 4, CB3 infection had induced MT approximately 10-fold, regardless of TCDD treatment (P < 0.01 in infected mice and P < 0.001 in infected, TCDD-treated mice). TCDD alone induced a 10-fold increase in CYP1A1 activity (P < 0.001), whereas infection alone suppressed the normal CYP1A1 activity by 75% (P < 0.001). Infection also suppressed the TCDD-induced CYP1A1 activity by approximately 30% (n.s.). Poly I/C suppressed CYP1A1 by 20-25% (n.s.) at both basal and TCDD-induced levels. Serum IFN-alpha and IFN-beta levels were undetectable in controls, in TCDD-treated and in the poly I/C-treated groups on day 4, probably because the short IFN peak is detectable only hours after injection. Conversely, on day 4 of the infection, IFN-alpha and IFN-beta were consistently raised in the TCDD-treated infected mice, whereas increased IFNs as a result of infection alone could be detected in only one individual. These results suggest that the normal host responses during acute infections down-regulate detoxifying processes in favour of acute-phase protein synthesis. This may explain the observed changed pattern of accumulation, excretion and toxicity of the environmental pollutants cadmium and TCDD during this common virus infection.
|
|
| 6. |
- Lövgren, Tanja, et al.
(author)
-
Induction of interferon-α production in plasmacytoid dendritic cells by immune complexes containing nucleic acid released by necrotic or late apoptotic cells and lupus IgG
- 2004
-
In: Arthritis and Rheumatism. - : Wiley. - 0004-3591 .- 1529-0131. ; 50:6, s. 1861-1872
-
Journal article (peer-reviewed)abstract
- OBJECTIVE: To investigate the release of interferon-alpha (IFN alpha)-inducing material by necrotic or apoptotic cells, its properties, and the necessity of autoantibodies from systemic lupus erythematosus (SLE) patients for the interferogenic activity. METHODS: U937 monocytic leukemia cells or peripheral blood mononuclear cells (PBMCs) were rendered necrotic by freeze-thawing or apoptotic by treatment with ultraviolet light. Cell culture supernatants from these cells and IgG from SLE patients (SLE IgG) were added to cultures of normal PBMCs or purified plasmacytoid dendritic cells (PDCs). The importance of nucleic acids for IFN alpha induction was investigated by RNase and DNase treatment. The IFN alpha levels were measured by immunoassay. RESULTS: Both necrotic and apoptotic U937 cells released material that, combined with SLE IgG, induced IFN alpha production in PDCs. The release from apoptotic cells occurred with a 16-hour delay, in late apoptosis. Also, normal PBMCs released IFN alpha-inducing material, but only during necrosis. The interferogenic activity of the necrotic material required the presence of RNA, while both RNA and DNA were important in the apoptotic material. In both cases, the presence of SLE IgG was necessary, and its activity correlated with the presence of antibodies to RNA-binding proteins, but not anti-DNA antibodies. CONCLUSION: Necrotic and late apoptotic cells release material that, combined with SLE IgG, induces production of IFN alpha in PDCs. The IFN alpha inducers probably consist of immune complexes (ICs) containing RNA and possibly DNA as essential interferogenic components. The presence of such interferogenic ICs could explain the ongoing production of IFN alpha in SLE and could be of etiopathogenic importance.
|
|
| 7. |
- Magnusson, Mattias, et al.
(author)
-
The plasmid pcDNA3 differentially induces production of interferon-alpha and interleukin-6 in cultures of porcine leukocytes
- 2001
-
In: Veterinary Immunology and Immunopathology. - : Elsevier. - 0165-2427 .- 1873-2534. ; 78:1, s. 45-56
-
Journal article (peer-reviewed)abstract
- An adjuvant effect of invertebrate DNA has been attributed to its relative high frequency of unmethylated CpG dinucleotides. Here we describe the interferon-alpha (IFN-alpha) and interleukin-6 (IL-6) inducing properties of a commonly used eukaryotic expression vector, pcDNA3, in porcine leukocytes. The magnitude of the cytokine response was compared to that induced by the synthetic ds RNA analogue poly(I):poly(C), inactivated preparations of Aujeszkys disease virus (ADV) and the Gram-negative bacteria Actinobacillus pleuropneumoniae. The plasmid, as well as poly(I):poly(C), required lipofectin to induce IFN-alpha production whereas both preparations induced IL-6 irrespective of preincubation with lipofectin. However, the nucleic acid-induced levels of IL-6 were low compared to those induced by A. pleuropneumoniae. The IFN-alpha response elicited by pcDNA3 in the presence of lipofectin was as high as, or higher than that induced by ADV. Interestingly, also A. pleuropneumoniae induced a substantial production of IFN-alpha when preincubated with lipofectin. Plasmid expression was not necessary for induction of IFN-alpha. Furthermore, the IFN-alpha. inducing capacity of pcDNA3 was not reduced when the two predicted immunostimulatory sequences 5AACGTT3 were deleted. Nor did the ability of the plasmid to induce IFN-alpha production decrease when the ampicillin resistance (ampR) gene was replaced with the kanamycin resistance (kanR) gene. However, methylation of all cytidines in CpG dinucleotides of pcDNA3 abolished the IFN-alpha inducing capacity. These in vitro results indicate an immunomodulatory role of bacterial DNA also in the pig. Unmethylated CpG dinucleotides are crucial for induction of IFN-alpha by the plasmid, but other CpG motifs than those within the 5AACGTT3 sequences of the ampR gene contribute to this induction in porcine cells. (C) 2001 Elsevier Science B.V. All rights reserved.
|
|
| 8. |
- Rönnblom, Lars, et al.
(author)
-
Role of natural interferon-alpha producing cells (plasmacytoid dendritic cells) in autoimmunity
- 2003
-
In: Autoimmunity. - : Informa UK Limited. - 0891-6934 .- 1607-842X. ; 36:8, s. 463-72
-
Journal article (peer-reviewed)abstract
- The type I interferons (IFNs) have antiviral, cytostatic and prominent immunomodulatory effects, which all are of great importance during viral infections. However, prolonged exposure of the immune system to type I IFN can break tolerance and initiate an autoimmune reaction, eventually leading to autoimmune disease. Recent observations in patients with systemic lupus erythematosus (SLE) have revealed that such individuals have endogenous IFN-alpha inducers, causing an ongoing IFN-alpha production and consequently a continuous stimulation of the immune system. These IFN-alpha inducers consist of small immune complexes (IC) containing DNA or RNA and act on the principal IFN-alpha producing cell, the natural IFN-alpha producing cell (NIPC), also termed the plasmacytoid dendritic cell (PDC). The NIPC/PDC is a key cell in both the innate and adaptive immune response but can also, either directly or via produced IFN-alpha, have a pivotal role in autoimmunity. In this review we summarize recent data concerning NIPC/PDC, including their activation, regulation, function and possible role in autoimmune diseases, especially SLE.
|
|
