1. |
- Bellucci, Valerio, et al.
(författare)
-
Hard X-ray stereographic microscopy for single-shot differential phase imaging
- 2023
-
Ingår i: Optics Express. - 1094-4087. ; 31:11, s. 18399-18406
-
Tidskriftsartikel (refereegranskat)abstract
- The characterisation of fast phenomena at the microscopic scale is required for the understanding of catastrophic responses of materials to loads and shocks, the processing of materials by optical or mechanical means, the processes involved in many key technologies such as additive manufacturing and microfluidics, and the mixing of fuels in combustion. Such processes are usually stochastic in nature and occur within the opaque interior volumes of materials or samples, with complex dynamics that evolve in all three dimensions at speeds exceeding many meters per second. There is therefore a need for the ability to record three-dimensional X-ray movies of irreversible processes with resolutions of micrometers and frame rates of microseconds. Here we demonstrate a method to achieve this by recording a stereo phase-contrast image pair in a single exposure. The two images are combined computationally to reconstruct a 3D model of the object. The method is extendable to more than two simultaneous views. When combined with megahertz pulse trains of X-ray free-electron lasers (XFELs) it will be possible to create movies able to resolve 3D trajectories with velocities of kilometers per second.
|
|
2. |
|
|
3. |
- Han, Huijong, et al.
(författare)
-
The XBI BioLab for life science experiments at the European XFEL
- 2021
-
Ingår i: Journal of applied crystallography. - 0021-8898 .- 1600-5767. ; 54, s. 7-21
-
Tidskriftsartikel (refereegranskat)abstract
- The science of X-ray free-electron lasers (XFELs) critically depends on the performance of the X-ray laser and on the quality of the samples placed into the X-ray beam. The stability of biological samples is limited and key biomolecular transformations occur on short timescales. Experiments in biology require a support laboratory in the immediate vicinity of the beamlines. The XBI BioLab of the European XFEL (XBI denotes XFEL Biology Infrastructure) is an integrated user facility connected to the beamlines for supporting a wide range of biological experiments. The laboratory was financed and built by a collaboration between the European XFEL and the XBI User Consortium, whose members come from Finland, Germany, the Slovak Republic, Sweden and the USA, with observers from Denmark and the Russian Federation. Arranged around a central wet laboratory, the XBI BioLab provides facilities for sample preparation and scoring, laboratories for growing prokaryotic and eukaryotic cells, a Bio Safety Level 2 laboratory, sample purification and characterization facilities, a crystallization laboratory, an anaerobic laboratory, an aerosol laboratory, a vacuum laboratory for injector tests, and laboratories for optical microscopy, atomic force microscopy and electron microscopy. Here, an overview of the XBI facility is given and some of the results of the first user experiments are highlighted.
|
|
4. |
- Larsson, Andreas, et al.
(författare)
-
Analysis of NMR J couplings in partially protected galactopyranosides*
- 2002
-
Ingår i: Organic Letters. - : American Chemical Society. - 1523-7052 .- 1523-7060. ; 4:11, s. 1831-1834
-
Tidskriftsartikel (refereegranskat)abstract
- Hydrogen bond mediated NMR J couplings offer additional structural information. The interpretation of these usually small hJ couplings are,however, not necessarily straightforward. In the present case of a carbohydrate system, a four-bond classical W coupling, 4JHO4,H5, is morereasonable on the basis of, in particular, density functional theory calculations of spin-spin coupling constants at the UB3LYP/6-311G** levelof theory.
|
|
5. |
- Perepelytsya, Sergiy, et al.
(författare)
-
Pattern preferences of DNA nucleotide motifs by polyamines putrescine(2+), spermidine(3+)and spermine(4+)
- 2019
-
Ingår i: Nucleic Acids Research. - : Oxford University Press (OUP). - 0305-1048 .- 1362-4962. ; 47:12, s. 6084-6097
-
Tidskriftsartikel (refereegranskat)abstract
- The interactions of natural polyamines (putrescine(2+), spermidine(3+)and spermine(4+)) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine(2+), spermidine(3+)and spermine(4+) in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.
|
|
6. |
- Rebič, Matúš, et al.
(författare)
-
Coarse-Grained Simulation of Rodlike Higher-Order Quadruplex Structures at Different Salt Concentrations
- 2017
-
Ingår i: ACS Omega. - : American Chemical Society (ACS). - 2470-1343. ; 2:2, s. 386-396
-
Tidskriftsartikel (refereegranskat)abstract
- We present a coarse-grained (CG) model of a rodlike higher-order quadruplex with explicit monovalent salts, which was developed from radial distribution functions of an underlying reference atomistic molecular dynamics simulation using inverse Monte Carlo technique. This work improves our previous CG model and extends its applicability beyond the minimal salt conditions, allowing its use at variable ionic strengths. The strategies necessary for the model development are clearly explained and discussed. The effects of the number of stacked quadruplexes and varied salt concentration on the elasticity of the rodlike higher-order quadruplex structures are analyzed. The CG model reproduces the deformations of the terminal parts in agreement with experimental observations without introducing any special parameters for terminal beads and reveals slight differences in the rise and twist of the G-quartet arrangement along the studied biopolymer. The conclusions of our study can be generalized for other G-quartet-based structures.
|
|
7. |
- Rebic, Matus, et al.
(författare)
-
Molecular Dynamics Simulation Study of Parallel Telomeric DNA Quadruplexes at Different Ionic Strengths : Evaluation of Water and Ion Models
- 2016
-
Ingår i: Journal of Physical Chemistry B. - : American Chemical Society (ACS). - 1520-6106 .- 1520-5207. ; 120:30, s. 7380-7391
-
Tidskriftsartikel (refereegranskat)abstract
- Most molecular dynamics (MD) simulations of DNA quadruplexes have been performed under minimal salt conditions using the Aqvist potential parameters for the cation with the TIP3P water model. Recently, this combination of parameters has been reported to be problematic for the stability of quadruplex DNA, especially caused by the ion interactions inside or near the quadruplex channel. Here, we verify how the choice of ion parameters and water model can affect the quadruplex structural stability and the interactions with the ions outside the channel. We have performed a series of MD simulations of the human full-parallel telomeric quadruplex by neutralizing its negative charge with K+ ions. Three combinations of different cation potential parameters and water models have been used: (a) Aqvist ion parameters, TIP3P water model; (b) Joung and Cheatham ion parameters, TIP3P water model; and (c) Joung and Cheatham ion parameters, TTP4P(ew) water model. For the combinations (b) and (c), the effect of the ionic strength has been evaluated by adding increasing amounts of KCl salt (50, 100, and 200 mM). Two independent simulations using the Aqvist parameters with the TIP3P model show that this combination is clearly less suited for the studied quadruplex with K+ counterions. In both simulations, one ion escapes from the channel, followed by significant deformation of the structure, leading to deviating conformation compared to that in the reference crystallographic data. For the other combinations of ion and water potentials, no tendency is observed for the channel ions to escape from the quadruplex channel. In addition, the internal mobility of the three loops, torsion angles, and counterion affinity have been investigated at varied salt concentrations. In summary, the selection of ion and water models is crucial as it can affect both the structure and dynamics as well as the interactions of the quadruplex with its counterions. The results obtained with the TIP4P(ew) model are found to be closest to the experimental data at all of the studied ion concentrations.
|
|
8. |
- Rebic, Matus, et al.
(författare)
-
Multiscale Simulations of Human Telomeric G-Quadruplex DNA
- 2015
-
Ingår i: Journal of Physical Chemistry B. - : American Chemical Society (ACS). - 1520-6106 .- 1520-5207. ; 119:1, s. 105-113
-
Tidskriftsartikel (refereegranskat)abstract
- We present a coarse-grain (CG) model of human telomeric G-quadruplex, obtained using the inverse Monte Carlo (IMC) and iterative Boltzmann inversion (IBI) techniques implemented within the software package called MagiC. As a starting point, the 2HY9 human telomeric [3 + 1] hybrid, a 26-nucleobase sequence, was modeled performing a 1 mu s long atomistic molecular dynamics (MD) simulation. The chosen quadruplex includes two kinds of loops and all possible combinations of relative orientations of guanine strands that can be found in quadruplexes. The effective CG potential for a one bead per nucleotide model has been developed from the radial distribution functions of this reference system. The obtained potentials take into account explicitly the interaction with counterions, while the effect of the solvent is included implicitly. The structural properties of the obtained CG model of the quadruplex provided a perfect match to those resulting from the reference atomistic MD simulation. The same set of interaction potentials was then used to simulate at the CG level another quadruplex topology (PDB id 1KF1) that can be formed by the human telomeric DNA sequence. This quadruplex differs from 2HY9 in the loop topology and G-strand relative orientation. The results of the CG MD simulations of 1KF1 are very encouraging and suggest that the CG model based on 2HY9 can be used to simulate quadruplexes with different topologies. The CG model was further applied to a higher order human telomeric quadruplex formed by the repetition, 20 times, of the 1KF1 quadruplex structure. In all cases, the developed model, which to the best of our knowledge is the first model of quadruplexes at the CG level presented in the literature, reproduces the main structural features remarkably well.
|
|
9. |
- Soyama, Hitoshi, et al.
(författare)
-
Revealing the origins of vortex cavitation in a Venturi tube by high speed X-ray imaging
- 2023
-
Ingår i: Ultrasonics Sonochemistry. - 1350-4177. ; 101
-
Tidskriftsartikel (refereegranskat)abstract
- Hydrodynamic cavitation is useful in many processing applications, for example, in chemical reactors, water treatment and biochemical engineering. An important type of hydrodynamic cavitation that occurs in a Venturi tube is vortex cavitation known to cause luminescence whose intensity is closely related to the size and number of cavitation events. However, the mechanistic origins of bubbles constituting vortex cavitation remains unclear, although it has been concluded that the pressure fields generated by the cavitation collapse strongly depends on the bubble geometry. The common view is that vortex cavitation consists of numerous small spherical bubbles. In the present paper, aspects of vortex cavitation arising in a Venturi tube were visualized using high-speed X-ray imaging at SPring-8 and European XFEL. It was discovered that vortex cavitation in a Venturi tube consisted of angulated rather than spherical bubbles. The tangential velocity of the surface of vortex cavitation was assessed considering the Rankine vortex model.
|
|
10. |
- Vagovič, Patrik, et al.
(författare)
-
Megahertz x-ray microscopy at x-ray free-electron laser and synchrotron sources
- 2019
-
Ingår i: Optica. - 2334-2536. ; 6:9, s. 1106-1109
-
Tidskriftsartikel (refereegranskat)abstract
- Modern emerging technologies, such as additive manufacturing, bioprinting, and new material production, require novel metrology tools to probe fundamental high-speed dynamics happening in such systems. Here we demonstrate the application of the megahertz (MHz) European X-ray Free-Electron Laser (EuXFEL) to image the fast stochastic processes induced by a laser on water-filled capillaries with micrometer-scale spatial resolution. The EuXFEL provides superior contrast and spatial resolution compared to equivalent state-of-the-art synchrotron experiments. This work opens up new possibilities for the characterization of MHz stochastic processes on the nanosecond to microsecond time scales with object velocities up to a few kilometers per second using XFEL sources.
|
|