Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells

↓ Direkt till sidans innehåll
↓ Direkt till sidans sekundära innehåll (sidomenyn)

Sökning: WFRF:(Alm Gunnar V.) > (2000-2004) > Characteristics of ...

Domeika, KristinaSwedish University of Agricultural Sciences, Uppsala, Sweden (författare)

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells

Artikel/kapitelEngelska2004

Förlag, utgivningsår, omfång ...

Elsevier,2004
printrdacarrier

Nummerbeteckningar

LIBRIS-ID:oai:DiVA.org:liu-87943
https://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-87943URI
https://doi.org/10.1016/j.vetimm.2004.04.017DOI

Kompletterande språkuppgifter

Språk:engelska
Sammanfattning på:engelska

Ingår i deldatabas

SwePubSwePub

Klassifikation

Ämneskategori:ref swepub-contenttype
Ämneskategori:art swepub-publicationtype

Anmärkningar

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.

Ämnesord och genrebeteckningar

porcine; interferon; IFN-alpha producing cells; dendritic cells; CpG-DNA

Biuppslag (personer, institutioner, konferenser, titlar ...)

Magnusson, MattiasSwedish University of Agricultural Sciences, Uppsala, Sweden(Swepub:liu)matma88 (författare)
Eloranta, Maija-LeenaSwedish University of Agricultural Sciences, Uppsala, Sweden (författare)
Fuxler, LisbethSwedish University of Agricultural Sciences, Uppsala, Sweden (författare)
Alm, Gunnar V.Swedish University of Agricultural Sciences, Uppsala, Sweden (författare)
Fossum, CarolineSwedish University of Agricultural Sciences, Uppsala, Sweden (författare)
Swedish University of Agricultural Sciences, Uppsala, Sweden (creator_code:org_t)

Sammanhörande titlar

Ingår i:Veterinary Immunology and Immunopathology: Elsevier101:1-2, s. 87-1020165-24271873-2534

Internetlänk

Hitta via bibliotek

Veterinary Immunology and Immunopathology (Sök värdpublikationen i LIBRIS)

Till lärosätets databas

Hitta mer i SwePub

Av författaren/redakt...: Domeika, Kristin ...; Magnusson, Matti ...; Eloranta, Maija- ...; Fuxler, Lisbeth; Alm, Gunnar V.; Fossum, Caroline

Artiklar i publikationen: Veterinary Immun ...

Av lärosätet: Linköpings universitet

Sök utanför SwePub

Sök vidare i:: Google; Google Book Search; Google Scholar

Kungliga biblioteket hanterar dina personuppgifter i enlighet med EU:s dataskyddsförordning (2018), GDPR. Läs mer om hur det funkar här.
Så här hanterar KB dina uppgifter vid användning av denna tjänst.

LIBRIS.kb.se