Pattern preferences of DNA nucleotide motifs by polyamines putrescine(2+), spermidine(3+)and spermine(4+)

• The interactions of natural polyamines (putrescine(2+), spermidine(3+)and spermine(4+)) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine(2+), spermidine(3+)and spermine(4+) in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

Ämnesord

NATURVETENSKAP  -- Kemi (hsv//swe)

NATURAL SCIENCES  -- Chemical Sciences (hsv//eng)

Publikations- och innehållstyp

ref (ämneskategori)

art (ämneskategori)